960 resultados para microscopy


Relevância:

10.00% 10.00%

Publicador:

Resumo:

It was done microencapsulation of natural essencial orange oil through spray-drying. The purpose was to use the best proportion of wall materials among maltodextrin, acacia gum, and modified starch (capsul) in order to retain greater amount of orange oil. The orange oil (10%) and maltodextrin (36%) remained constant. Three spray drying temperatures were employed: 180°C, 200°C and 220°C, therefore, nine final products were obtained. The superficial and inner oil concentrations were measured. The microcapsules were also examined through optical and scanning electron microscopy. The three temperatures employed did not affect the microencapsulation. The microstructure of the capsules were almost similar regardless the proportion employed among the carbohydrates to wall composition. At light microscopy it was observed a great heterogeneity of capsules diameters, and probably not smooth surfaces; at scanning electron microscopy it was clear that the walls displayed porosity over round surfaces. The best retention was given by the formula containing 10% of capsul, 10% of orange oil and 36% of maltodextrin, when total oil retention was 94%, regardless the drying temperature here employed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVE: The aim of this study was to evaluate the capacity of potassium oxalate, fluoride gel and two kinds of propolis gel to reduce the hydraulic conductance of dentin, in vitro. MATERIAL AND METHODS: The methodology used for the measurement of hydraulic conductance of dentin in the present study was based on a model proposed in literature. Thirty-six 1-mm-thick dentin discs, obtained from extracted human third molars were divided into 4 groups (n=9). The groups corresponded to the following experimental materials: GI-10% propolis gel, pH 4.1; GII-30% propolis gel; GIII-3% potassium oxalate gel, pH 4,1; and GIV-1.23% fluoride gel, pH 4.1, applied to the dentin under the following surface conditions: after 37% phosphoric acid and before 6% citric acid application. The occluding capacity of the dentin tubules was evaluated using scanning electron microscopy (SEM) at ×500, ×1,000 and ×2,000 magnifications. Data were analyzed statistically by two-way ANOVA and Tukey's test at 5% significance level. RESULTS: Groups I, II, III, IV did not differ significantly from the others in any conditions by reducing in hydraulic conductance. The active agents reduced dentin permeability; however they produced the smallest reduction in hydraulic conductance when compared to the presence of smear layer (P<0.05). The effectiveness in reducing dentin permeability did not differ significantly from 10% or 30% propolis gels. SEM micrographs revealed that dentin tubules were partially occluded after treatment with propolis. CONCLUSIONS: Under the conditions of this study, the application of 10% and 30% propolis gels did not seem to reduce the hydraulic conductance of dentin in vitro, but it showed capacity of partially obliterating the dentin tubules. Propolis is used in the treatment of different oral problems without causing significant great collateral effects, and can be a good option in the treatment of patients with dentin sensitivity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This in situ study investigated, using scanning electron microscopy, the effect of stimulated saliva on the enamel surface of bovine and human substrates submitted to erosion followed by brushing abrasion immediately or after one hour. During 2 experimental 7-day crossover phases, 9 previously selected volunteers wore intraoral palatal devices, with 12 enamel specimens (6 human and 6 bovine). In the first phase, the volunteers immersed the device for 5 minutes in 150 ml of a cola drink, 4 times a day (8h00, 12h00, 16h00 and 20h00). Immediately after the immersions, no treatment was performed in 4 specimens (ERO), 4 other specimens were immediately brushed (0 min) using a fluoride dentifrice and the device was replaced into the mouth. After 60 min, the other 4 specimens were brushed. In the second phase, the procedures were repeated but, after the immersions, the volunteers stimulated the salivary flow rate by chewing a sugar-free gum for 30 min. Enamel superficial alterations of all specimens were then evaluated using a scanning electron microscope. Enamel prism core dissolution was seen on the surfaces submitted to erosion, while on those submitted to erosion and to abrasion (both at 0 and 60 min) a more homogeneous enamel surface was observed, probably due to the removal of the altered superficial prism layer. For all the other variables - enamel substrate and salivary stimulation -, the microscopic pattern of the enamel specimens was similar.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The association between a toothbrush and a dentifrice is the most used denture cleaning method. The purpose of this study was to evaluate the abrasiveness of specific and non-specific denture cleaning dentifrices on different heat-polymerized acrylic resins. Sixteen specimens (90x30x3mm) of each acrylic resin (QC-20, Lucitone 550, Clássico, Vipi-Cril) were prepared and randomly assigned to 4 groups: 1: control (distilled water), 2: Colgate, 3: Bonyplus and 4: Dentu-Creme. The specimens were subjected to simulated toothbrushing in an automatic brushing machine using 35,600 brush strokes for each specimen. Brushing abrasion run at a 200-g load with the specimens immersed in 2:1 dentifrice/water slurry. Specimens were reconditioned to constant mass and the mass loss (mg) was evaluated. Data were analyzed by 2-way ANOVA and Tukey's test (a=0.05). Analysis of dentifrices' abrasive particles was made by scanning electron microscopy. Colgate produced the greatest mass reduction (42.44 mg, p<0.05), followed by Dentu-Creme (33.60 mg). Bonyplus was the less abrasive (19.91 mg), similar to the control group (19.69 mg) (p>0.05). The mass loss values indicated that QC-20 (33.13 mg) and Lucitone 550 (33.05 mg) resins were less (p<0.05) resistant to abrasion than Clássico (26.04 mg) and Vipi-Cril (23.43 mg). In conclusion, Colgate produced the greatest abrasion. Specific dentifrices for dentures tend to cause less damage to acrylic resins.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Dentin hypersensitivity (DH) is a painful response to stimulus applied to the open dentinal tubules of a vital tooth. It's a common oral condition, however, without an ideal treatment available yet. This work evaluated in vitro the effect of micron-sized particles from a novel bioactive glass-ceramic (Biosilicate) in occluding open dentinal tubules. A dentin disc model was employed to observe comparatively, using scanning electron microscopy (SEM), dentinal tubule occlusion by different products and deposition of hydroxyl carbonate apatite (HCA) on dentin surface by Biosilicate, after a single application: G1 - Dentifrice with potassium nitrate and fluoride; G2 - Two-step calcium phosphate precipitation treatment; G3 - Water-free gel containing Biosilicate particles (1%); G4 - Biosilicate particles mixed with distilled water in a 1:10 ratio; all of them after 1, 12 and 24 hours of immersion in artificial saliva. Fourier transform infrared spectroscopy (FTIR) was performed to detect HCA formation on dentin discs filled with Biosilicate after 2 minutes, 30 minutes and 12 hours of immersion in artificial saliva. SEM showed a layer of HCA formed on dentin surface after 24 hours by G4. G1, G2 and G3 promoted not total occlusion of open dentinal tubules after 24 hours. FTIR showed HCA precipitation on the dentin surface induced by Biosilicate after 30 minutes. The micron-sized particles from the bioactive glass-ceramic thus were able to induce HCA deposition in open dentinal tubules in vitro. This finding suggests that Biosilicate may provide a new option for treating DH.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Calcium phosphate salts, or more specifically hydroxyapatite, are products of great interest in the fields of medical and dental science due to their biocompatibility and osteoconduction property. Deproteinized xenografts are primarily constituted of natural apatites, sintered or not. Variations in the industrial process may affect physicochemical properties and, therefore, the biological outcome. The purpose of this work was to characterize the physical and chemical properties of deproteinized xenogenic biomaterials, Bio-Oss (Geistlich Biomaterials, Wolhuser, Switzerland) and Gen-Ox (Baumer S.A., Brazil), widely used as bone grafts. Scanning electron microscopy, infrared region spectroscopy, X-ray diffraction, thermogravimetry and degradation analysis were conducted. The results show that both materials presented porous granules, composed of crystalline hydroxyapatite without apparent presence of other phases. Bio-Oss presented greater dissolution in Tris-HCl than Gen-Ox in the degradation test, possibly due to the low crystallinity and the presence of organic residues. In conclusion, both commercial materials are hydroxyapatite compounds, Bio-Oss being less crystalline than Gen-Ox and, therefore, more prone to degradation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Removable partial dentures (RPD) demand specific hygienic cleaning and the combination of brushing with immersion in chemical solutions has been the most recommended method for control of biofilm. However, the effect of the cleansers on metallic components has not been widely investigated. This study evaluated the effect of different cleansers on the surface of RPD. Five disc specimens (12 mm x 3 mm metallic disc centered in a 38 x 18 x 4 mm mould filled with resin) were obtained for each experimental situation: 6 solutions [Periogard (PE), Cepacol (CE), Corega Tabs (CT), Medical Interporous (MI), Polident (PO), 0.05% sodium hypochlorite (NaOCl), and distilled water (DW) control] and 2 Co-Cr alloys [DeguDent (DD) and VeraPDI (VPDI)] were used for each experimental situation. A 180-day immersion was simulated and the measurements of roughness (Ra, µm) of metal and resin were analyzed using 2-way ANOVA and Tukey’s test. The surface changes and tarnishes were examined with a scanning electronic microscopy (SEM). In addition, energy dispersive x-ray spectrometry (EDS) analysis was carried out at representative areas. Visually, NaOCl and MI specimens presented surface tarnishes. The roughness of materials was not affected by the solutions (p>0.05). SEM images showed that NaOCl and MI provided surface changes. EDS analysis revealed the presence of oxygen for specimens in contact with both MI and NaOCl solutions, which might suggest that the two solutions promoted the oxidation of the surfaces, thus leading to spot corrosion. Within the limitations of this study, it may be concluded that the NaOCl and MI may not be suitable for cleaning of RPD.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Prostaglandins control osteoblastic and osteoclastic function under physiological or pathological conditions and are important modulators of the bone healing process. The non-steroidal anti-inflammatory drugs (NSAIDs) inhibit cyclooxygenase (COX) activity and consequently prostaglandins synthesis. Experimental and clinical evidence has indicated a risk for reparative bone formation related to the use of non-selective (COX-1 and COX-2) and COX-2 selective NSAIDs. Ketorolac is a non-selective NSAID which, at low doses, has a preferential COX-1 inhibitory effect and etoricoxib is a new selective COX-2 inhibitor. Although literature data have suggested that ketorolac can interfere negatively with long bone fracture healing, there seems to be no study associating etoricoxib with reparative bone formation. Paracetamol/acetaminophen, one of the first choices for pain control in clinical dentistry, has been considered a weak anti-inflammatory drug, although supposedly capable of inhibiting COX-2 activity in inflammatory sites. OBJECTIVE: The purpose of the present study was to investigate whether paracetamol, ketorolac and etoricoxib can hinder alveolar bone formation, taking the filling of rat extraction socket with newly formed bone as experimental model. MATERIAL AND METHODS: The degree of new bone formation inside the alveolar socket was estimated two weeks after tooth extraction by a differential point-counting method, using an optical microscopy with a digital camera for image capture and histometry software. Differences between groups were analyzed by ANOVA after confirming a normal distribution of sample data. RESULTS AND CONCLUSIONS: Histometric results confirmed that none of the tested drugs had a detrimental effect in the volume fraction of bone trabeculae formed inside the alveolar socket.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study evaluated the influence of a cola-type soft drink and a soy-based orange juice on the surface and subsurface erosion of primary enamel, as a function of the exposure time. Seventy-five primary incisors were divided for microhardness test (n=45) or scanning electron microscopy (SEM) analysis (n=30). The specimens were randomly assigned to 3 groups: 1 - artificial saliva (control); 2 - cola-type soft drink; and 3 - soy-based orange juice. Immersion cycles in the beverages were undertaken under agitation for 5 min, 3 times a day, during 60 days. Surface microhardness was measured at 7, 15, 30, 45 and 60 days. After 60 days, specimens were bisected and subsurface microhardness was measured at 30, 60, 90, 120, 150 and 200 µm from the surface exposed. Data were analyzed by ANOVA and Tukey’s test (a=0.05). Groups 2 and 3 presented similar decrease of surface microhardness. Regarding subsurface microhardness, group 2 presented the lowest values. SEM images revealed that after 60 days the surfaces clearly exhibited structural loss, unlike those immersed in artificial saliva. It may be concluded that erosion of the surfaces exposed to the cola-type soft drink was more accentuated and directly proportional to the exposure time.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This ex vivo study evaluated dentin permeability of the root canal in the apical third of different human groups of teeth. Eighty teeth were used, 8 from each dental group: maxillary and mandibular central incisors, lateral incisors and canines, maxillary first premolars (buccal and palatal roots), mandibular first premolars, and maxillary and mandibular second premolars, totalizing 88 roots that were distributed in 11 groups. The root canals were instrumented, irrigated with 1% NaOCl and 15% EDTA. Roots were immersed in 10% copper sulfate for 30 min and then in 1% rubeanic acid alcohol solution for the same period; this chemical reaction reveals dentin permeability by the formation of copper rubeanate, which is a dark-colored compound. Semi-serial 100-µm-thick cross-sections were obtained from the apical third of the roots. Five sections of each apical third were washed, dehydrated, cleared and mounted on glass slides for examination under optical microscopy. The percentage of copper ion infiltration and the amount of tubular dentin were quantified by morphometric analysis. The penetration of copper ions in the apical third ranged from 4.60 to 16.66%. The mandibular central and lateral incisors presented the highest dentin permeability (16.66%), while the maxillary canines and mandibular second and first premolars presented the lowest dentin permeability (4.60%, 4.80% and 5.71%, respectively; p<0.001). The other teeth presented intermediate permeability. In conclusion, dye penetration into dentin tubules at the apical region is strongly dependent on the group of teeth evaluated.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study evaluated in vitro the capacity of debris removal from the apical third of flattened root canals, using different final irrigation protocols. Thirty human mandibular central incisors with a mesiodistal flattened root were prepared using rotary instrumentation by Endo-Flare 25.12 and Hero 642 30.06, 35.02, 40.02 files, irrigated with 2 mL of 1% NaOCl after each file. The specimens were randomly distributed into 5 groups according to the final irrigation of root canals: Group I: 10 mL of distilled water (control), Group II: 10 mL of 1% NaOCl for 8 min, Group III: 2 mL of 1% NaOCl for 2 min (repeated 4 times), Group IV: 10 mL of 2.5% NaOCl for 8 min, and Group V: 10 mL of 2.5% NaOCl for 2 min (repeated 4 times). The apical thirds of the specimens were subjected to histological processing and 6-μm cross-sections were obtained and stained with hematoxylin-eosin. The specimens were examined under optical microscopy at ×40 magnification and the images were subjected to morphometric analysis using the Scion image-analysis software. The total area of root canal and the area with debris were measured in square millimeters. Analysis of variance showed no statistically significant difference (p>0.05) among the groups GI (2.39 ± 3.59), GII (2.91 ± 2.21), GIII (0.73 ± 1.36), GIV (0.95 ± 0.84) and GV (0.51 ± 0.22). In conclusion, the final irrigation protocols evaluated in this study using the Luer syringe presented similar performance in the removal of debris from the apical third of flattened root canals.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study evaluated in vitro the shear bond strength (SBS) of a resin-based pit-and-fissure sealant [Fluroshield (F), Dentsply/Caulk] associated with either an etch-and-rinse [Adper Single Bond 2 (SB), 3M/ESPE] or a self-etching adhesive system [Clearfil S3 Bond (S3), Kuraray Co., Ltd.] to saliva-contaminated enamel, comparing two curing protocols: individual light curing of the adhesive system and the sealant or simultaneous curing of both materials. Mesial and distal enamel surfaces from 45 sound third molars were randomly assigned to 6 groups (n=15), according to the bonding technique: I - F was applied to 37% phosphoric acid etched enamel. The other groups were contaminated with fresh human saliva (0.01 mL; 10 s) after acid etching: II - SB and F were light cured separately; III - SB and F were light cured together; IV - S3 and F were light cured separately; V - S3 and F were light cured simultaneously; VI - F was applied to saliva-contaminated, acid-etched enamel without an intermediate bonding agent layer. SBS was tested to failure in a universal testing machine at 0.5 mm/min. Data were analyzed by one-way ANOVA and Fisher's test (α=0.05).The debonded specimens were examined with a stereomicroscope to assess the failure modes. Three representative specimens from each group were observed under scanning electron microscopy for a qualitative analysis. Mean SBS in MPa were: I-12.28 (±4.29); II-8.57 (±3.19); III-7.97 (±2.16); IV-12.56 (±3.11); V-11.45 (±3.77); and VI-7.47 (±1.99). In conclusion, individual or simultaneous curing of the intermediate bonding agent layer and the resin sealant did not seem to affect bond strength to saliva-contaminated enamel. S3/F presented significantly higher SBS than the that of the groups treated with SB etch-and-rinse adhesive system and similar SBS to that of the control group, in which the sealant was applied under ideal dry, noncontaminated conditions.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The use of an adequate method for evaluation of the adhesion of root canal filling materials provides more reliable results to allow comparison of the materials and substantiate their clinical choice. The aims of this study were to compare the shear bond strength (SBS) test and push-out test for evaluation of the adhesion of an epoxy-based endodontic sealer (AH Plus) to dentin and gutta-percha, and to assess the failure modes on the debonded surfaces by means of scanning electron microscopy (SEM). Three groups were established (n=7): in group 1, root cylinders obtained from human canines were embedded in acrylic resin and had their canals prepared and filled with sealer; in group 2, longitudinal sections of dentin cylinders were embedded in resin with the canal surface smoothed and turned upwards; in group 3, gutta-percha cylinders were embedded in resin. Polyethylene tubes filled with sealer were positioned on the polished surface of the specimens (groups 2 and 3). The push-out test (group 1) and the SBS test (groups 2 and 3) were performed in an Instron universal testing machine running at crosshead speed of 1 mm/min. Means (±SD) in MPa were: G1 (8.8±1.13), G2 (5.9±1.05) and G3 (3.8±0.55). Statistical analysis by ANOVA and Student's t-test (a=0.05) revealed statistically significant differences (p<0.01) among the groups. SEM analysis showed a predominance of adhesive and mixed failures of AH Plus sealer. The tested surface affected significantly the results with the sealer reaching higher bond strength to dentin than to gutta-percha with the SBS test. The comparison of the employed methodologies showed that the SBS test produced significantly lower bond strength values than the push-out test, was skilful in determining the adhesion of AH Plus sealer to dentin and gutta-percha, and required specimens that could be easily prepared for SEM, presenting as a viable alternative for further experiments.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVE: The aim of this study was to evaluate the morphology of glass (GF), carbon (CF) and glass/carbon (G/CF) fiber posts and their bond strength to self or dual-cured resin luting agents. MATERIAL AND METHODS: Morphological analysis of each post type was conducted under scanning electron microscopy (SEM). Bond strength was evaluated by microtensile test after bisecting the posts and re-bonding the two halves with the luting agents. Data were subjected to two-way ANOVA and Tukey's test (α=0.05). Failure modes were evaluated under optical microscopy and SEM. RESULTS: GF presented wider fibers and higher amount of matrix than CF, and G/CF presented carbon fibers surrounded by glass fibers, and both involved by matrix. For CF and GF, the dual-cured material presented significantly higher (p<0.05) bond strength than the self-cured agent. For the dual agent, CF presented similar bond strength to GF (p>0.05), but higher than that of G/CF (p<0.05). For the self-cured agent, no significant differences (p>0.05) were detected, irrespective of the post type. For GF and G/CF, all failures were considered mixed, while a predominance of adhesive failures was detected for CF. CONCLUSION: The bonding between fiber posts and luting agents was affected by the type of fibers and polymerization mode of the cement. When no surface treatment of the post is performed, the bonding between glass fiber post and dual-cured agent seems to be more reliable.