Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Anomalias dentárias associadas: o ortodontista decodificando a genética que rege os distúrbios de desenvolvimento dentário

O presente trabalho versa sobre o diagnóstico e a abordagem ortodôntica das anomalias dentárias, enfatizando os aspectos etiológicos que definem tais irregularidades de desenvolvimento. Parece existir uma inter-relação genética na determinação de algumas dessas anomalias, considerando-se a alta frequência de associações. Um mesmo defeito genético pode originar diferentes manifestações fenotípicas, incluindo agenesias, microdontias, ectopias e atraso no desenvolvimento dentário. As implicações clínicas das anomalias dentárias associadas são muito relevantes, uma vez que o diagnóstico precoce de uma determinada anomalia dentária pode alertar o clínico sobre a possibilidade de desenvolvimento de outras anomalias associadas no mesmo paciente ou em outros membros da família, permitindo a intervenção ortodôntica em época oportuna.

Effect of cyclic load on vertical misfit of prefabricated and cast implant single abutment

OBJECTIVES: The purpose of this in vitro study was to evaluate misfit alterations at the implant/abutment interface of external and internal connection implant systems when subjected to cyclic loading. MATERIAL AND METHODS: Standard metal crowns were fabricated for 5 groups (n=10) of implant/abutment assemblies: Group 1, external hexagon implant and UCLA cast-on premachined abutment; Group 2, internal hexagon implant and premachined abutment; Group 3, internal octagon implant and prefabricated abutment; Group 4, external hexagon implant and UCLA cast-on premachined abutment; and Group 5, external hexagon implant and Ceraone abutment. For groups 1, 2, 3 and 5, the crowns were cemented on the abutments and in group 4 crowns were screwed directly on the implant. The specimens were subjected to 500,000 cycles at 19.1 Hz of frequency and non-axial load of 133 N in a MTS 810 machine. The vertical misfit (μm) at the implant/abutment interface was evaluated before (B) and after (A) application of the cyclic loading. Data were analyzed statistically by using two-away ANOVA and Tukey's post-hoc test (p<0.05). RESULTS: Before loading values showed no difference among groups 2 (4.33±3.13), 3 (4.79±3.43) and 5 (3.86±4.60); between groups 1 (12.88±6.43) and 4 (9.67±3.08), and among groups 2, 3 and 4. However, groups 1 and 4 were significantly different from groups 2, 3 and 5. After loading values of groups 1 (17.28±8.77) and 4 (17.78±10.99) were significantly different from those of groups 2 (4.83±4.50), 3 (8.07±4.31) and 5 (3.81±4.84). There was a significant increase in misfit values of groups 1, 3 and 4 after cyclic loading, but not for groups 2 and 5. CONCLUSIONS: The cyclic loading and type of implant/abutment connection may develop a role on the vertical misfit at the implant/abutment interface.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Evaluation of DNA extraction protocols for Brucella abortus pcr detection in aborted fetuses or calves born from cows experimentally infected with strain 2308

The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.

A closer look at multiple-clone Plasmodium vivax infections: detection methods, prevalence and consequences

The naturally occurring clonal diversity among field isolates of the major human malaria parasite Plasmodium vivax remained unexplored until the early 1990s, when improved molecular methods allowed the use of blood samples obtained directly from patients, without prior in vitro culture, for genotyping purposes. Here we briefly review the molecular strategies currently used to detect genetically distinct clones in patient-derived P. vivax samples, present evidence that multiple-clone P. vivax infections are commonly detected in areas with different levels of malaria transmission and discuss possible evolutionary and epidemiological consequences of the competition between genetically distinct clones in natural human infections. We suggest that, when two or more genetically distinct clones are present in the same host, intra-host competition for limited resources may select for P. vivax traits that represent major public health challenges, such as increased virulence, increased transmissibility and antimalarial drug resistance.

Pre-processing for noise detection in gene expression classification data

Due to the imprecise nature of biological experiments, biological data is often characterized by the presence of redundant and noisy data. This may be due to errors that occurred during data collection, such as contaminations in laboratorial samples. It is the case of gene expression data, where the equipments and tools currently used frequently produce noisy biological data. Machine Learning algorithms have been successfully used in gene expression data analysis. Although many Machine Learning algorithms can deal with noise, detecting and removing noisy instances from the training data set can help the induction of the target hypothesis. This paper evaluates the use of distance-based pre-processing techniques for noise detection in gene expression data classification problems. This evaluation analyzes the effectiveness of the techniques investigated in removing noisy data, measured by the accuracy obtained by different Machine Learning classifiers over the pre-processed data.

Development of instrumentation for amperometric and coulometric detection using ultramicroelectrodes

In this work it is presented the development of a simple, portable and inexpensive instrumentation for amperometric and coulometric detection in different analytical instrumentation systems utilizing ultramicroelectrodes. The software, developed in LabVIEW 7.1TM, is capable to carry out three main detection techniques (amperometric, pulsed amperometric and coulometric detection) and a voltammetric technique (cyclic voltammetry). The instrumentation was successfully evaluated using the following systems: cyclic voltammograms of metallic electrodes in alkaline solutions, flow electrochemical detection of glucose and glycine and direct determination of herbicide glyphosate (electrochemical detection coupled to HPLC).

Métodos para fabricação de microeletrodos visando a detecção em microambientes

Analysis at microenvironments, like single cells or in minute volumes (nL), is an area of great interest for analytical and biological sciences. Measurements at these experimental conditions demand analytical tools (microelectrodes) capable of monitoring with rapid response, good resolution and minimal perturbation of the system. The major drawbacks in producing these microscopic electrodes have been largely overcome, principally due to the development of new fabrication methods. In this review, these procedures are described with emphasis to those devoted to the construction of microelectrodes for application in microenvironments. Examples of our efforts to use these devices as effective electrochemical sensors are also addressed.

Tempo de vida útil de propelentes base-simples

The purpose of this work was to determine the safe shelf life of single-base propellants. The kinetic parameters relative to the consumption of the stabilizer diphenylamine (DPA) added to the propellant were determined as a function of the storage and ageing time. High Performance Liquid Chromatography (HPLC) with spectrophotometric detection was used to determine the DPA percentage before and after the artificial ageing at 60, 70 and 80 ºC. The experimental data were very well adjusted to a pseudo-first order kinetic model and the respective kinetic constants are 8.0-10-3 day-1 (60 ºC); 1.9-10-2 day-1 (70 ºC); 1.2-10-1 day-1 (80 ºC). The activation energy was calculated as 130 kJ mol-1 and the half-time for depletion of the DPA at the hypothetical temperature of 40 ºC of storage was estimated as being 6 years.

Determination of picloram in waters by sequential injection chromatography with UV detection

This paper describes a sequential injection chromatography procedure for determination of picloram in waters exploring the low backpressure of a 2.5 cm long monolithic C18 column. Separation of the analyte from the matrix was achieved in less than 60 s using a mobile phase composed by 20:80 (v v-1) acetonitrile:5.0 mmol L-1 H3PO4 and flow rate of 30 μL s-1. Detection was made at 223 nm with a 40 mm optical path length cell. The limits of detection and quantification were 33 and 137 μg L-1, respectively. The proposed method is sensitive enough to monitor the maximum concentration level for picloram in drinking water (500 μg L-1). The sampling frequency is 60 analyses per hour, consuming only 300 μL of acetonitrile per analysis. The proposed methodology was applied to spiked river water samples and no statistically significant differences were observed in comparison to a conventional HPLC-UV method.