995 resultados para Adesão plaquetária
Resumo:
O presente estudo tem como objetivo apresentar, por meio de uma revisão de literatura, aspectos relevantes sobre a temática: adesão às medidas preventivas de acidentes com materiais biológicos de trabalhadores de Enfermagem atuantes na Atenção Básica à Saúde. Esta revisão narrativa possui conteúdos extraídos de artigos publicados nas seguintes bases de dados e bibliotecas virtuais: Scientific Electronic Library Online (SCIELO), Biblioteca Virtual em Saúde (BIREME) e Literatura Latino-americana e do Caribe em Ciências da Saúde (LILACS). Também foram utilizados acervos de bibliotecas universitárias, onde foram selecionados artigos científicos, teses, dissertações, monografias, anais de eventos, dentre outros materiais relevantes para este estudo. Os trabalhadores de Enfermagem, sobretudo aqueles que atuam diretamente com os pacientes, estão constantemente sujeitos a fatores ocupacionais que colocam em risco sua segurança e saúde. Neste sentido, é importante que os profissionais sejam capazes de avaliar estes riscos, principalmente os biológicos, e buscar preveni-los ou minimiza-los, seja por meio da utilização de Equipamentos de Proteção Individual, ou de uma postura ativa que privilegie as medidas preventivas. Assim, esta revisão de literatura constitui-se como o primeiro passo de um longo caminho que necessita de uma equipe de enfermagem empenhada e disposta a agir em favor de sua própria qualidade de vida
Resumo:
Dental materials that release fluoride have been shown to be effective in caries inhibition around restorations. Adhesive materials would also be effective in caries inhibition by sealing and protecting cavity margins from acidic demineralization. This in vitro study tested the hypothesis that composite restorations with a dentin adhesive system have a caries preventive effect similar to that of an adhesive material with fluoride - glass-ionomer cement - on root surfaces. Twenty roots from extracted sound third molars were embedded in polystyrene resin and ground flat. Standardized cavities were prepared in leveled root surfaces and randomly restored with (a) Chelon-Fil (Espe) or (b) Z100/SingleBond (3M). Baseline indentations were measured at 100, 200 and 300 mum from the occlusal margins of each restoration and the surface microhardness values were obtained using a Knoop diamond indenter. A 2.0 mm wide margin around the restorations was submitted to a pH-cycling model, at 37ºC. After that, surface microhardness was measured again, as it was before. The differences between baseline and final surface microhardness were considered for statistical analysis. The median values of differences were (a): -3.8; -0.3; -1.0; and (b): 3.3; 2.5; 1.7, for the distances of 100, 200 and 300 mum, respectively. The Kruskal-Wallis test did not show statistically significant difference between 100, 200 and 300 mum distances in each tested group. There was no difference between the studied materials at the distances of 200 and 300 mum. Chelon-Fil was statistically different from Z100/SingleBond, at 100 mum (p<0.05). Under the studied conditions, the glass-ionomer cement had a higher caries preventive effect than the composite/dentin adhesive restorations.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Purpose: Amblyopia is the most common form of visual problem in children and for more than 250 years occlusion therapy is the standard treatment. Thus our purpose is to identify the factors that influence the outcome of amblyopia treatment with occlusion therapy. Methods: We reviewed 169 amblyopic children seen in the outpatient clinic of amblyopia of the Campinas State University, between January 1996 and May 1998. Patients were analyzed regar-ding sex, age at start of treatment (3 groups), affected eye, type of amblyopia (strabismic, anisometropic, visual depri-vation, associated), follow-up, initial visual acuity (light, moderate, severe), compliance with treatment (good, poor) and outcome (fully treated, partially treated, not treated). Results: Compliance was not seen to be significantly related to age at start of treatment (p=0.68) or initial visual acuity (p=0.82). 52.67% of the patients were fully treated while 19.52% were partially treated and 27.81% were not treated. Children recorded as showing good compliance had a significantly better outcome than those with poor complian-ce (p=0.0009). Neither the age at start of treatment (p=0.39) nor the initial visual acuity (p=0.30) were significantly corre-lated with the final outcome. Conclusions: We concluded that the main factor affecting the final outcome of amblyopia treatment is compliance.
Resumo:
Purpose: An experimental study to evaluate the behavior of polytetrafluoroethylene (Gore-Tex®) compared with human sclera, in scleral perforations induced in rabbits eyes was performed. Methods: Twenty-two eyes of rabbits were submitted to scleral perforation followed by Gore-Tex® graft in the left eye and human sclera graft in the right eye respectively. During one month the postoperative evolution was analyzed every day: intensity of hyperemia, presence of infection, secretion, rejection and tonicity of the eyes. Results: No cases of secretion, infection or rejection were observed. The histological sections showed fibrosis in the eyes with Gore-Tex®, good adhesion and epithelization. Conclusion: The Gore-Tex® showed to be a plausible material to be used as graft in scleral defects with some advantages such as easy obtention, good handling and durability.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
INTRODUÇÃO: apesar da colagem direta despender menor tempo clínico, com maior preservação da integridade gengival, ainda hoje se observa uma alta incidência de bandagem dos molares. Portanto, torna-se interessante a idealização de recursos para o aumento da eficiência desse procedimento para dentes submetidos a maiores impactos mastigatórios, como, por exemplo, os molares. OBJETIVO: esse estudo teve o propósito de avaliar se a resistência à adesão com a aplicação de uma camada de resina adicional na região oclusal da interface tubo/dente aumenta a qualidade do procedimento de colagem direta de tubos em molares. MÉTODOS: selecionou-se uma amostra composta por 40 terceiros molares inferiores, que foram aleatoriamente divididos em 2 grupos: Grupo 1 - colagem direta convencional, seguida pela aplicação de uma camada de resina na oclusal da interface tubo/dente; e Grupo 2 - colagem direta convencional. O teste de resistência ao cisalhamento foi realizado 24 horas após a colagem, utilizando-se uma máquina de ensaio universal, operando a uma velocidade de 0,5mm/min. Os resultados foram analisados por meio do teste t independente. RESULTADOS: os valores médios obtidos nos testes de cisalhamento foram: 17,08MPa para o Grupo 1 e 12,60MPa para o Grupo 2. O Grupo 1 apresentou uma resistência ao cisalhamento estatisticamente significativa mais alta do que o Grupo 2. CONCLUSÃO: a aplicação de uma camada adicional de resina na oclusal da interface tubo/dente aumenta a qualidade da adesão do procedimento de colagem direta de tubos ortodônticos em molares.
Resumo:
The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.
Resumo:
This study evaluated in vitro the shear bond strength of a resin-based pit-and-fissure sealant (Fluroshield - F) associated with either an ethanol-based (Adper Single Bond 2 - SB) or an acetone-based (Prime & Bond - PB) adhesive system under conditions of oil contamination. Mesial and distal enamel surfaces from 30 sound third molars were randomly assigned to 2 groups (n=30): I - no oil contamination; II - oil contamination. Contamination (0.25 mL during 10 s) was performed after 37% phosphoric acid etching with an air/oil spray. The specimens were randomly assigned to subgroups, according to the bonding protocol adopted: subgroup A - F was applied to enamel without an intermediate bonding agent layer; In subgroups B and C, SB and PB, respectively, were applied, light-cured, and then F was applied and light-cured. Shear bond strength was tested at a crosshead speed of 0.5 mm/min in a universal testing machine. Means (± SD) in MPa were: IA-11.28 (±1.84); IIA-12.02 (±1.15); IB-9.73 (±2.38); IIB-9.62 (±2.29); IC-28.30 (±1.63); and IIC-25.50 (±1.91). It may be concluded that the oil contamination affected negatively the sealant bonding to enamel and the acetone-based adhesive system (PB) layer applied underneath the sealant was able to prevent its deleterious effects to adhesion.
Resumo:
The acellular dermal matrix (ADM) was introduced in periodontology as a substitute for the autogenous grafts, which became restricted because of the limited source of donor's tissue. The aim of this study was to investigate, in vitro, the distribution, proliferation and viability of human gingival fibroblasts seeded onto ADM. ADM was seeded with human gingival fibroblasts for up to 21 days. The following parameters were evaluated: cell distribution, proliferation and viability. Results revealed that, at day 7, fibroblasts were adherent and spread on ADM surface, and were unevenly distributed, forming a discontinuous single cell layer; at day 14, a confluent fibroblastic monolayer lining ADM surface was noticed. At day 21, the cell monolayer exhibited a reduction in cell density. At 7 days, about to 90% of adherent cells on ADM surface were cycling while at 14 and 21 days this proportion was significantly reduced. A high proportion of viable cell was detected on AMD surface both on 14 and 21 days. The results suggest that fibroblast seeding onto ADM for 14 days can allow good conditions for cell adhesion and spreading on the matrix; however, migration inside the matrix was limited.
Resumo:
Micropartículas produzidas a partir de polímeros sintéticos têm sido amplamente utilizadas na área farmacêutica para encapsulação de princípios ativos. Essas micropartículas apresentam as vantagens de proteção do princípio ativo, mucoadesão e gastrorresistência, melhor biodisponibilidade e maior adesão do paciente ao tratamento. Além disso, utiliza menores quantidade de princípio ativo para obtenção do efeito terapêutico proporcionando diminuição dos efeitos adversos locais, sistêmicos e menor toxidade. Os polímeros sintéticos empregados na produção das micropartículas são classificados biodegradáveis ou não biodegradáveis, sendo os biodegradáveis mais utilizados por não necessitam ser removidos cirurgicamente após o término de sua ação. A produção das micropartículas poliméricas sintéticas para encapsulação tanto de ativos hidrofílicos quanto hidrofóbicos pode ser emulsificação por extração e/ou evaporação do solvente; coacervação; métodos mecânicos e estão revisados neste artigo evidenciando as vantagens, desvantagens e viabilidade de cada metodologia. A escolha da metodologia e do polímero sintético a serem empregados na produção desse sistema dependem da aplicação terapêutica requerida, bem como a simplicidade, reprodutibilidade e factibilidade do aumento de escala da produção.
Resumo:
BACKGROUND: Mentoring Programs have been developed in several medical schools, but few studies have investigated the mentors'perspective. PURPOSES: To explore mentors'perceptions regarding their experience. METHODS: Mentors at a medical school were invited to participate in an in-depth interview including questions on satisfaction, difficulties, and perception of changes resulting from the program. RESULTS: Mentors' satisfaction and difficulties are strongly associated with students'involvement in the activity. Mentors believe changes observed in students were more related to life issues; for some mentors, there is no recognition or awareness of the program. However, most of the mentors acknowledged important changes in relation to themselves: as teachers, faculty members, and individuals. CONCLUSION: Attendance is crucial for both the mentoring relationship and strengthening of the program. Students involved in the activity motivate mentors in teaching and curriculum development, thereby creating a virtuous circle and benefiting undergraduate medical education as a whole.
Resumo:
Croton celtidifolius Baill is a tree found in the Atlantic Forest South of Brazil, mainly in Santa Catarina. The bark and leaf infusions of this medicinal plant have been popularly used for the treatment of inflammatory diseases. The anti-aggregant activity of C. celtidifolius crude extract (CE) and the column chromatography (CC) isolated compounds flavonoids, catechin and gallocatechin were evaluated in human blood platelets. The platelet-rich plasma (PRP) was incubated with different concentrations of flavonóides (50 - 200 µg/mL) to be tested before platelet aggregation was induced by the agonists adenosine 5'diphosphate (ADP) and collagen. At 200 µg/mL the CE, catechin and gallocatechin markedly inhibited platelet aggregation with the aggregant agents. Using ATP production as an index of platelet secretory capacity, we observed a decreased production of ATP in platelets treated with flavonoids when stimulated by collagen. On the other hand, the flavonoids did not promote inhibitory effect on prothrombin time (PT), thromboplastin time (APTT) and thrombin time (TT). In conclusion, these observations suggest that C. celtidifolius is likely to exert an inhibitory action on platelets in vitro by suppressing secretion and platelet aggregation.
Resumo:
Glaucoma Primário de Ângulo Aberto (GPAA) é uma importante causa de cegueira no mundo. O presente trabalho teve como objetivo investigar: (1) presença e tipo de estresse; (2) relação do número de colírios e estresse; (3) percepção do glaucoma e tratamento. Um estudo transversal e quantitativo foi realizado com 102 pacientes do Ambulatório de Oftalmologia do HC-FMUSP, com roteiro temático e Inventário de Sintomas de Estresse de Lipp. A maioria dos pacientes apresentou estresse (65,7%) e não houve correlação entre estresse e número de colírios. "Tempo de tratamento", "dificuldades na vida diária" e "dificuldades em pingar o colírio" foram variáveis independentemente associadas ao estresse. Conclui-se que o estresse pode interferir negativamente no enfrentamento da doença em pacientes com GPAA.