Modelos de regressão lineares para estimativa de produtividade da soja no oeste do Paraná, utilizando dados espectrais

The main objective of this work was to evaluate the linear regression between spectral response and soybean yield in regional scale. In this study were monitored 36 municipalities from the west region of the states of Parana using five images of Landsat 5/TM during 2004/05 season. The spectral response was converted in physical values, apparent and surface reflectances, by radiometric transformation and atmospheric corrections and both used to calculate NDVI and GVI vegetation indices. Those ones were compared by multiple and simple regression with government official yield values (IBGE). Diagnostic processing method to identify influents values or collinearity was applied to the data too. The results showed that the mean surface reflectance value from all images was more correlated with yield than individual dates. Further, the multiple regressions using all dates and both vegetation indices gave better results than simple regression.

A teoria e a prática: a questão da diferençano discurso sobre e da sala de aula

The main purpose of this paper is to question the relationship between theory and practice or basic and applied research in the domain of Applied Linguistics and classroom discourse. In order to achieve our aim, some theoretical texts, some recorded and transcribed classes as well as some teachers and students opinions about reading and writing were analysed. Results have shown that 1) practice is not the direct application of theoretical data: the relationship between them is not as simple as some applied linguists seem to believe because of the action of the unconscious in the constitution of subjectivity; 2) the conceptualization of the theoretical issues takes place in a confused and disorderly manner mixed up with personal experiences and previous knowledge (practice). We intend to question the fact that practice comes as secondary to theory.

A IDEOLOGIA DO SUPRIMIDO: OU, COMO NÃO TEORIZAR A RESPEITO DA IDEOLOGIA

In this paper, I argue against the contemporary tendency to confine ideology to the sphere of subjectivity and point of view, as defended by Paul Simpson (1993) in his book Language, Ideology, and Point of View. My principal criticism against the view is that it simply amounts to a re-affirmation of certain of the conceptual categories with which we have for long been accustomed to think. Rather, I contend, we ought to try to interrogate those very categories with a view to teasing out the instabilities that characterise them. I argue that there is an urgent need to deconstruct the very opposition between ideology, point of view etc. on the one hand, and science, theory, or whatever that one might wish to posit on the other.

Influência da idade no comportamento da frequência cardíaca na transição repouso-exercício: uma análise por deltas e regressão linear

BACKGROUND: Changes in heart rate during rest-exercise transition can be characterized by the application of mathematical calculations, such as deltas 0-10 and 0-30 seconds to infer on the parasympathetic nervous system and linear regression and delta applied to data range from 60 to 240 seconds to infer on the sympathetic nervous system. The objective of this study was to test the hypothesis that young and middle-aged subjects have different heart rate responses in exercise of moderate and intense intensity, with different mathematical calculations. METHODS: Seven middle-aged men and ten young men apparently healthy were subject to constant load tests (intense and moderate) in cycle ergometer. The heart rate data were submitted to analysis of deltas (0-10, 0-30 and 60-240 seconds) and simple linear regression (60-240 seconds). The parameters obtained from simple linear regression analysis were: intercept and slope angle. We used the Shapiro-Wilk test to check the distribution of data and the t test for unpaired comparisons between groups. The level of statistical significance was 5%. RESULTS: The value of the intercept and delta 0-10 seconds was lower in middle age in two loads tested and the inclination angle was lower in moderate exercise in middle age. CONCLUSION: The young subjects present greater magnitude of vagal withdrawal in the initial stage of the HR response during constant load exercise and higher speed of adjustment of sympathetic response in moderate exercise.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Aspecto tumoral da cisticercose intracraniana: abordagem cirúrgica

The cerebral cysticercosis can produce intracranial hypertension by inflammatory obstruction of the basal cysterns or by expansive lesion in the cerebral parenchima or ventricular cavities. In the latter and in tumor cases the clinical picture is very similar and only after surgery can the etiology be determined. We present 11 operated cases of intracranial cysticercosis which presented the clinical picture of an expansive lesion. There were 7 females and 4 males with ages between 4 and 65 years. Nine patients were admitted because of headache, vomiting and visual disturbances suggestive of intracranial hypertension. One patient was admited with lymphocytic meningitis and another with focal seizures following hemiparesis. Five patients presented focal signs and six edema of the papilla. Epileptic manifestations were present in 45.5% of the cases. A plain X-ray films of the skull failed to reveal calcificatons, however signs of chronic hypertension were present in three cases. The electroencephalogram showed slow focal waves in 8 patients The spinal fluid examination revealed lymphocytosis in 4 cases, increased protein content in another 4 and complement fixation for cysticercosis was positive in 2 cases. The expansive lesions were localized by angiograph and ventriculography. In these the location was temporal in 4, frontal in 3, parietal in 2, in the third ventricle in one and in the fourth ventricle in another. At surgery we removed a large cyst from the cerebral parenchyma in six cases. Around the cyst a thick glial reaction was present. In the other cases the cyst was small but fixed to the ventricular trigone and produced dilatation of the inferior horn of the lateral ventricle. In two cases we removed a solitary intraventricular cyst from the third and fourth ventricles. In the two children operated upon there were several small hard cysts involving the cerebral parenchyma which displayed intense gliosis. There were no postoperative complications.

Metodologia para descrição da orientação do corpo humano

Universidade Estadual de Campinas. Faculdade de Educação Física

Brincando no ambiente natural : uma contribuição para o desenvolvimento sensorio-motor da criança portadora de paralisia cerebral

Universidade Estadual de Campinas . Faculdade de Educação Física

Atividade fisica e saude : estudo do conhecimento de professores de educação fisica do ensino fundamental atraves da educação a distancia

Universidade Estadual de Campinas . Faculdade de Educação Física

Futebol : Analises qualitativas e quantitativas para verificação e modulação de padrões e sistemas complexos de jogo

Universidade Estadual de Campinas . Faculdade de Educação Física

Pedagogia de esporte : aspectos motriz de aprendizagem em hoquei em patins, crianças de oito a dez anos

Universidade Estadual de Campinas. Faculdade de Educação Física

Desenvolvimento de ferramentas de análise de desempenho de atletas em 3 diferentes modalidades : Handebol, Provas Combinadas e Salto com Vara

Universidade Estadual de Campinas. Faculdade de Educação Física

Possibilidades e limites da avaliação da qualidade de vida : análise dos instrumentos WHOQOL e modelos clássicos de qualidade de vida no trabalho = Possibilities and limits of quality of life assessment : analysis of WHOQOL instruments and quality of work life classical models

Universidade Estadual de Campinas . Faculdade de Educação Física

Futebol (tel)espetaculo como lazer : um exame sobre as manifestações do futebol brasileiro

Universidade Estadual de Campinas . Faculdade de Educação Física

Seleções olimpicas de basquetebol feminino do Brasil (2000 e 2004) : correlação entre variaveis tecnicas e fisicas

Universidade Estadual de Campinas . Faculdade de Educação Física