Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Do corpo no tempo ao tempo do corpo : a ciencia e a formação profissional em Educação Fisica

Universidade Estadual de Campinas. Faculdade de Educação Física

Qualidade de vida e avaliação fisica em intoxicados por mercurio : estudo observacional transversal descritivo

Universidade Estadual de Campinas . Faculdade de Educação Física

Desvelando os significados da vivencia da ginastica geral para adolescentes de uma instituição salesiana de proteção a criança e ao adolescente

Universidade Estadual de Campinas. Faculdade de Educação Física

Modificações morfo-funcionais do tecido muscular induzidas pela atividade excentrica : um estudo global dos processos adaptativos

Universidade Estadual de Campinas . Faculdade de Educação Física

Quality evaluation of DNA obtained from stored human saliva and its applicability to identification in Forensic Dentistry

PURPOSE: This study evaluated the quality of DNA obtained from stored human saliva and its applicability to human identification. METHODS: The saliva samples of 20 subjects, collected in the form of saliva in natura and from mouth swabs and stored at -20ºC, were analyzed. After 7 days, the DNA was extracted from the 40 saliva samples and subjected to PCR and electrophoresis. After 180 days, the technique was repeated with the 20 swab samples. RESULTS: The first-stage results indicated that DNA was successfully extracted in 97.5% of reactions, 95% of saliva in natura and 100% of swab saliva samples, with no statistically significant difference between the forms of saliva. In the second phase, the result was positive for all 20 analyzed samples (100%). Subsequently, in order to analyze the quality of the DNA obtained from human saliva, the SIX3-2 gene was tested on the 20 mouth swab samples, and the PCR products were digested using the MbO1 restriction enzyme to evaluate polymorphisms in the ADRA-2 gene, with positive results for most samples. CONCLUSION: It was concluded that the quantity and quality of DNA from saliva and the techniques employed are adequate for forensic analysis of DNA.

Manipulação do genoma humano: ética e direito

A biologia molecular tem fornecido as ferramentas básicas para os geneticistas se aprofundarem nos mecanismos moleculares que influem na variação das doenças. Deve-se destacar a responsabilidade científica e moral dos pesquisadores, uma vez que os cientistas devem imaginar as consequências morais da aplicação comercial de testes genéticos, já que esse fato envolve não só o indivíduo e suas famílias, mas toda a população. Além de ser preciso, também, fazer uma reflexão sobre como essas informações do genoma humano serão utilizadas, para o bem ou mal. O objetivo desta revisão foi trazer à luz do conhecimento dados sobre características éticas da aplicação da biologia molecular, relacionando-a com os direitos do ser humano. Após análise bibliográfica, pôde-se observar que o Projeto Genoma Humano gerou várias possibilidades, como identificação de genes associados a doenças com propriedades sinergísticas, mas modificando às vezes comportamentos ao intervir geneticamente no ser humano, trazendo benefícios ou malefícios sociais. O grande desafio é decidir o que a humanidade pretende em relação a este gigantesco salto.

Estudo morfofuncional das glândulas mamárias de Mão Pelada, Procyon cancrivorus

Para a descrição macro e microscópica das glândulas mamárias foram utilizadas três fêmeas de Mão Pelada (Procyon cancrivorus). As amostras das glândulas foram processadas conforme técnicas rotineiras para histologia. As fêmeas estudadas apresentaram 3 pares de glândulas mamárias, sendo um par de glândula mamária abdominal cranial, um par de abdominal caudal e um par de inguinal. As papilas mamárias apresentaram formato pendular, como os canídeos domésticos. Microscopicamente, a glândula mamária apresentou da porção externa para a interna: epiderme (epitélio estratificado pavimentoso queratinizado), derme (tecido conjuntivo frouxo e tecido conjuntivo denso não modelado), fibras musculares lisas e ductos papilíferos que abrem em vários ósteos papilares em formato de "chuveiro". A porção secretora glandular era caracteristicamente túbulo alveolar, com células cuboidais dispostas em camada simples. Os resultados indicam que o conjunto glandular estudado é semelhante ao da cadela (Cannis familiaris) tanto em seu aspecto macroscópico quanto em seu aspecto microscópico, este fato sugere que podemos utilizar o Mão Pelada e o Cão como modelos similares de estudo, para identificação de patologias relacionadas a este sistema.

O extrato de maracujá sobre a morfometria de hepatócitos da tilápia do Nilo

Avaliaram-se os efeitos do extrato de maracujá veiculado na dieta (0, 50, 100 e 200mg kg-1) sobre o consumo de alimento, o ganho em peso e os níveis de glicose e cortisol plasmático de juvenis de tilápias do Nilo (87,0±6,6g). Ao final do experimento (28 dias), os peixes foram eutanasiados para remoção do fígado, visando à avaliação da área citoplasmática, contagem de células e verificação dos estoques de glicogênio hepático. Os dados foram submetidos à ANOVA unidirecional, comparando-se as médias pelo Teste de Tukey (P<0,05), com posterior estudo de regressão, buscando estabelecer as curvas das áreas citoplasmáticas, em função das diferentes doses do extrato. A inclusão do extrato na dieta não afetou o consumo de alimento e o crescimento e todos os peixes apresentaram aumento da glicose e redução do cortisol plasmático, porém sem diferenças entre os tratamentos. As curvas de regressão indicaram aumento quadrático da área citoplasmática com a elevação da doses do extrato, principalmente para 100mg kg-1, resultando em uma curva dose-resposta em forma de "U" invertido. O aumento da área do citoplasma decorreu de um acúmulo de glicogênio hepático, conforme comprovado pela prova da amilase salivar. Concluiu-se que o extrato de maracujá pode ser fornecido na dieta de juvenis de tilápia, sem prejudicar o consumo alimentar e o crescimento dos animais e que o produto altera a morfometria dos hepatócitos, sugerindo a atividade de flavonóides sobre o metabolismo de carboidratos.

Origin of successive cambia on stem in three species of Menispermaceae

The lianas observed in this study, Abuta convexa (Vell.) Diels, Abuta imene (Mart.) Eichler, and Chondrodendron platiphyllum (A. St.-Hil.) Miers, all have successive cambia in their stems. The terminology applied to stem histology in species with successive cambia is as diverse as the interpretations of the origins of this cambial variant. Therefore, this study specifically investigates the origin of successive cambia through a developmental analysis of the above-mentioned species, including an analysis of the terminology used to describe this cambial variation. For the first time, we have identified several developmental stages giving rise to the origins of successive cambia in this family. First, the pericycle originates in 1-3 layers of conjunctive tissue. After the differentiation of the first ring, the conjunctive tissue undergoes new divisions, developing approximately 10 rows of parenchyma cells. In the middle portion, a layer of sclereids is formed, again subdividing the conjunctive tissue into two parts: internal and external. New cambia originate in the internal part, from which new secondary vascular strands will originate, giving rise to the second successive vascular ring of the stem. The external part remains parenchymatous during the installation of the second ring and will undergo new periclinal division, repeating the entire process. New cambia will originate from the neoformed strands, which will form only rays. In the literature, successive cambia are formed by a meristem called "diffuse lateral meristem."However, based on the species of Menispermaceae studied in this report, it is demonstrated that the diffuse lateral meristem is the pericycle itself.

Effects of uterine cervix constriction on Wistar rats

PURPOSE: To verify if uterine cerclage can induce craniosynostosis or any cranial deformity in new born Wistar rats. METHODS: One pregnant female Wistar rat underwent laparotomy on day 18 of gestation and the uterus cervix was closed with a 3-0 nylon suture to avoid delivery, that occurs normally on the 21 day. The suture was released after 48 hours beyond the normal gestation period. The female rat delivered 11 pups. Six surviving rats from the delivery (group A - constrained group). Two rats were born from another mother and in the same age were used as control group (group B - 2 nonconstrained controls) were allowed to grow. They were sacrificed 1.2 years after their birth all the eight animals. Linear measurement, routine histology and computed tomography of the skull were performed at the time of their death to evaluate the cranial asymmetries by mesurements of the anatomical landmarks of the craniofacial skeleton of the rats on the two groups and compared then. RESULTS: We did not observe statistically significant differences in any of the compared measurements (p>0.05) obtained through the morphologic and radiologic methods. Histologic examinations did not reveal any sign of premature fusion or suture imbrications. Critical decrease in longitudinal body size was noticed as the limbs too in all the animals of group A. CONCLUSION: Constriction of uterine cervix leads to fetus suffering, even death for a few animals, associated to small body size, but not to craniosynostosis.

An unusual, dwarf new species of Neotropical freshwater stingray, Plesiotrygon nana sp. nov., from the upper and mid Amazon basin: the second species of Plesiotrygon (Chondrichthyes: Potamotrygonidae)

A new species of the relatively poorly known Neotropical freshwater stingray genus Plesiotrygon Rosa, Castello & Thorson, 1987 is described from the main channel and smaller tributaries (Ríos Itaya and Pachitea) of the upper Amazon basin in Peru. The first specimen to be collected, however, was from much farther east in Rio Solimões in 1996, just down-river from Rio Purus (specimen unavailable for this study). Plesiotrygon nana sp. nov., is a very distinctive and unusually small species of freshwater stingray (Potamotrygonidae), described here mostly from three specimens representing different size classes and stages of sexual maturity. Plesiotrygon nana sp. nov., is distinguished from its only congener, P. iwamae Rosa, Castello & Thorson, 1987, by numerous unique features, including: dorsal coloration composed of very fine rosettes or a combination of spots and irregular ocelli; very circular disc and snout; very small and less rhomboidal spiracles; short snout and anterior disc region; narrow mouth and nostrils; denticles on dorsal tail small, scattered, not forming row of enlarged spines; adult and preadult specimens with significantly fewer tooth rows; fewer caudal vertebrae; higher total pectoral radials; very small size, probably not surpassing 250 mm disc length or width, males maturing sexually at around 180 mm disc length and 175 mm disc width; distal coloration of tail posterior to caudal stings usually dark purplish-brown; and features of the ventral lateral-line canals (hyomandibular canal very narrow, infraorbital and supraorbital canals not undulated, supraorbital and infraorbital loops small and narrow, supraorbital loop very short, not extending posteriorly to level of mouth, jugular and posterior infraorbital canals short, not extending caudally to first gill slits, subpleural loop very narrow posteriorly; absence of anterior and posterior subpleural tubules). To provide a foundation for the description of P. nana sp. nov., morphological variation in P. iwamae was examined based on all type specimens as well as newly collected and previously unreported material. Two specimens topotypic with the male paratype of P. nana sp. nov., referred to here as Plesiotrygon cf. iwamae, are also reported. Relationships of the new species to P. iwamae are discussed; further characters indicative of Plesiotrygon monophyly are proposed, but the genus may still not be valid. Plesiotrygon nana sp. nov., is commercialized with some regularity in the international aquarium trade from Iquitos (Peru), an alarming circumstance because nothing is known of its biology or conservation requirements.

Sob o signo de Darwin? Sobre o mau uso de uma quimera

No ano de 2003 Francisco de Oliveria publicou um artigo intitulado "O Ornitorrinco" no qual fez considerações críticas sobre a conjectura politico-social daquele momento histórico. Tal artigo é permeado por um paralelo entre o evolucionismo darwinista e a visão do autor sobre a sociedade brasileira contemporânea. Entretanto, ao fazer tal analogia ele incorre numa série de equívocos teóricos sobre a teoria evolucionista. Tais equívocos consistem, em grande parte, numa substuição indevida entre aquilo que ficou conhecido como Darwinismo Social e a teoria neodarwinista como entendida pelos seus atuais proponentes. O presente trabalho identifica estes equívocos e os contextualiza dentro da teoria neodarwiniana. Além disso, fazemos um recorte histórico do processo de formação do pensamento evolucionista para enfatizar que a associação entre biologia e darwinismo social é mais complexa do que geralmente se assume.

A revision of the Neotropical Solenopsidini ant genus Oxyepoecus Santschi, 1926 (Hymenoptera: Formicidae: Myrmicinae): 2. Final. Key for species and revision of the Rastratus species-group

In the first paper of this series (Albuquerque & Brandão, 2004) we revised the Vezenyii species group of the exclusively Neotropical solenopsidine (Myrmicinae) ant genus Oxyepoecus. In this closing paper we update distribution information on the Vezenyii group species and revise the other Oxyepoecus species-group (Rastratus). We describe two species (Oxyepoecus myops n. sp. and O. rosai n. sp.) and redescribe previously known species of the group [O. daguerrei (Santschi, 1933), O. mandibularis (Emery, 1913), O. plaumanni Kempf, 1974, O. rastratus Mayr, 1887, and O. reticulatus Kempf, 1974], adding locality records and comments on the meagre biological data of these species. We also present an identification key to Oxyepoecus species based on workers.

A comparison of the leaf-litter ant fauna in a secondary atlantic forest with an adjacent pine plantation in southeastern Brazil

We investigated the influence of Pinus afforestation on the structure of leaf-litter ant communities in the southeastern Brazilian Atlantic Forest, studying an old secondary forest and a nearly 30 year-old never managed Pinus elliottii reforested area. A total of 12,826 individual ants distributed among 95 species and 32 genera were obtained from 50 1 m² samples/ habitat. Of these, 60 species were recorded in the pine plantation and 82 in the area of Atlantic forest; almost 50% of the species found in the secondary forest area were also present in the pine plantation. The number of species per sample was significantly higher in the secondary forest than in the pine plantation. Forest-adapted taxa are the most responsible for ant species richness differences between areas, and the pine plantation is richer in species classified as soil or litter omnivorous-dominants. The specialized ant predators registered in the pine plantation, as seven Dacetini, two Basiceros, two Attini and two Discothyrea, belong to widely distributed species. The NMDS (non-metric multidimensional scaling) ordination also suggested strong differences in similarity among samples of the two areas. Furthermore, this analysis indicated higher sample heterogeneity in the secondary forest, with two clusters of species, while in the pine plantation the species belong to a single cluster. We applied the ant mosaic hypothesis to explain the distribution of the leaf-litter fauna and spatial autocorrelation tests among samples. We argue that the results are likely related to differences in quality and distribution of the leaf-litter between the pine plantation and the secondary area.