Eletroforese de isoenzimas de plântulas na identificação de espécies de Brachiaria

Lotes de sementes de braquiária comercializados no Brasil vem apresentando contaminações com sementes de outras espécies pertencentes ao mesmo gênero. Deste modo, uma das espécies de braquiária atuaria como planta infestante da outra no agroecossistema e a erradicação da espécie infestante seria dificultada pela agressividade característica do gênero e pela falta de seletividade dos herbicidas disponíveis no mercado. Esses fatores ressaltam a importância da comercialização e utilização de lotes de sementes isento de sementes de outras espécies e a utilização de metodologias precisas de identificação das principais espécies de braquiária no controle de qualidade das empresas produtoras de sementes. Neste trabalho, buscou-se avaliar o potencial discriminante da técnica de eletroforese, utilizando quatro sistemas enzimáticos presentes em plântulas de quatro espécies do gênero Brachiaria, quer sejam B. brizantha cv. Marandu, B. decumbens cv. Basilisk, B. humidicola cv. comercial e B. plantaginea. Foram realizadas análises de eletroforese de isoenzimas testando-se 50 indivíduos de cada espécie por tratamento, utilizando-se coleóptilos de plântulas obtidas a partir de sementes germinadas a 30°C, no escuro. Para a eletroforese foi utilizado como meio suporte géis de poliacrilamida, nas concentrações de 7,0 e 7,5%. As isoenzimas Glutamato desidrogenase e Glucose-6-fosfato desidrogenase, embora eficientes na diferenciação entre B. plantaginea e B. humidicola e entre as sementes dessas espécies e as de B. brizantha ou B. decumbens, não se mostraram capazes de diferenciar as sementes destas duas últimas espécies. Entretanto, as izoenzimas α- e β-esterase possibilitaram uma nítida diferenciação das quatro espécies de Brachiaria estudadas.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Avaliação, identificação e atividade enzimática de bactérias psicotróficas presentes no leite cru refrigerado

Extended storage of refrigerated milk can lead to reduced quality of raw and processed milk, which is a consequence of the growth and metabolic activities of psychrotrophic bacteria, able to grow under 7oC or lower temperatures. Although most of these microorganisms are destroyed by heat treatment, some have the potential to produce termoresistant proteolytic and lipolytic enzymes that can survive even UHT processing and reduce the processed products quality. Recently, the IN 51 determineds that milk should be refrigerated and stored at the farm what increased the importance of this group of microorganisms. In this work, psychrotrophic bacteria were isolated from 20 communitarian bulk tanks and 23 individual bulk tanks from dairy farms located at Zona da Mata region of Minas Gerais State and from southeastern Rio de Janeiro. Selected milk dilutions were plated on standard agar and after incubation for 10 days at 7oC, five colonies were isolated, firstly using nutrient agar and after using McConkey agar for 24 hours at 21oC. The isolates were identified by morphology, Gram stain method, catalase production, fermentative/oxidative metabolism and by API 20E, API 20NE, API Staph, API Coryne or API 50 CH (BioMerieux). In order to ensure reproductibility, API was repeated for 50% of the isolates. Species identification was considered when APILAB indexes reached 75% or higher. 309 strains were isolated, 250 Gram negative and 59 Gram positive. 250 Gram negative isolates were identified as: Acinetobacter spp. (39), Aeromonas spp. (07), A. Hydrophila (16), A. sobria (1), A. caviae (1), Alcaligenes feacalis (1), Burkholderia cepacia (12), Chryseomonas luteola (3), Enterobacter sp. (1), Ewingella americana(6), Hafnia alvei (7), Klebsiella sp. (1), Klebsiella oxytoca (10), Yersinia spp. (2), Methylobacterium mesophilicum (1), Moraxella spp. (4), Pantoea spp. (16), Pasteurella sp. (1), Pseudomonas spp. (10), P. fluorescens (94), P. putida (3), Serratia spp. (3), Sphigomonas paucomobilis (1). Five isolates kept unidentified. Pseudomonas was the predominant bacteria found (43%) and P. fluorescens the predominant species (37.6%), in accordance with previous reports. Qualitative analysis of proteolytic and lipolytic activity was based on halo formation using caseinate agar and tributirina agar during 72 hours at 21oC and during 10 days at 4°C, 10oC and 7°C. Among 250 Gram negative bacteria found, 104 were identified as Pseudomonas spp. and 60,57% of this group showed proteolytic and lipolytic acitivities over all four studied temperatures. 20% of Acinetobacter, Aeromonas, Alcaligenes, Burkholderia, Chryseomonas, Methylobacterium, Moraxella presented only lipolytic activity. Some isolates presented enzymatic activity in one or more studied temperatures. Among Gram positive bacteria, 30.51% were proteolytic and lipolytic at 10oC, 8.47% were proteolytic at 7oC, 10oC, and 21oC, 8.47% were proteolytic at all studied temperatures (4oC, 7oC, 10oC and 21oC) and 3.38% were proteolytic only at 21oC. At 4oC, only one isolate showed proteolytic activity and six isolates were lipolytic. In relation to Gram negative microorganisms, 4% were proteolytic and lipolytic at 7oC, 10oC and 21oC, 10% were proteolytic at 10oC and 4.4% were lipolytic at 4oC, 7oC, 10oC and 21oC, while 6.4% of all isolates were proteolytic and lipolytic at 10oC and 21oC as well as lipolytic at 4oC and 7oC. These findings are in accordance with previous researches that pointed out Pseudomonas as the predominant psycrotrophic flora in stored refrigerated raw milk

Utilização de análise de segregantes agrupados na identificação de marcadores ligados a genes que controlam a resistência à ferrugem (Puccinia psidii Winter) em Eucalyptus sp.

Devido a grande importância da cultura de Eucalyptus no Brasil, empresas do setor florestal têm buscado através de programas de melhoramento genético, reduzir as perdas de produção e atender a demanda do mercado de papel e celulose. Um exemplo, é a busca por genes de resistência a doenças, principalmente a ferrugem causada por Puccinia psidii Winter, que resulta em redução da produtividade em plantas altamente suscetíveis. No presente trabalho, mudas de Eucalyptus pertencentes a uma geração F1, provenientes do cruzamento controlado entre parentais híbridos E. grandis X E. urophylla, sendo eles resistente e suscetível, foram inoculadas com Puccinia psidii em casa de vegetação e acompanhadas até o aparecimento dos sintomas da ferrugem. Foram classificadas, em dois grupos: resistentes (ausência de sintomas) e suscetíveis (presença de sintomas e esporulação). As amostras de DNA foram comparadas com o uso de marcadores moleculares associado ao método de BSA (Bulked Segregant Analysis). O polimorfismo entre os grupos foi geneticamente relacionado ao loco que determina a característica de resistência ou sucetibilidade. Dentre os 720 primers testados, 19 foram polimórficos, porém, apenas o marcador AK 01 manteve-se presente, quando testado em todos os indivíduos da população, mostrando-se a uma distância genética estimada de 20 cM em repulsão ao gene de resistência.

Bidens mosaic virus: detecção via RT-PCR e identificação de Galinsoga parviflora como um novo hospedeiro natural do vírus

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Avaliação de bactérias nitrificantes em filtros biológicos submersos aerados

This study investigates a new treatment system of wastewater by anaerobic and aerobic biological filters for nitrogen modification. The main objective of this study was evaluate, on a pilot scale, quantitatively and qualitatively the bacterian nitrifying community in a experimental sewage treatment system made by aerobics biological filters in series, in search of figure out the dynamic of nitrogen modification process. It was collected and laboratorial analysed microbiologically, regarding NMP of Nitrosomonas e Nitrobacter, and physical-chemically considering nitrogen sequence. We conclude that: the association in aerobic biological filters under nutrition controlled conditions and oxygen level allows the appearance of bacterian community responsible for the nitrogen modification; the method used, despite its limitations, provided the selection of autotrophic nitrifying microorganisms, allowing the identification of Nitrosomonas and Nitrobacter; the flow direction tested in the experimental unit did not affect the nitrifying bacterial community, certainly because they were kept drowned and did not occur flow speed that could breake the formed biomass; the nitrification process happened in aerated biological filters in all phases of the research, comproved by microbiological tests; in the third phase of the research the increase of the oxygen rate was significant for the nitrificant bacterian community in the aerate biological filters, allowing its growth, occurring relation between the efficiency of nitrification system and the quantity of organisms responsible for this process; the conduit used in aerated biological filters showed satisfactory performance support material to the nitrifying bacteria development

Identificação de áreas com precipitação pluvial homogênea no Estado do Rio Grande do Norte

O estudo da variabilidade da precipitação é importante para o planejamento das atividades econômicas, possibilitando o uso mais eficiente e racional dos recursos hídricos. Dessa forma, o objetivo desta pesquisa é caracterizar o estado do Rio Grande do Norte com relação à variabilidade temporal da precipitação, agrupá-lo em regiões homogêneas e comparar diferentes técnicas de agrupamento. Para o estudo da variabilidade pluvial foram utilizados os índices: Grau de Concentração de Precipitação (PCD), que representa o grau em que a precipitação é distribuída ao longo do ano; e o Período de Concentração de Precipitação (PCP), que reflete o período no qual a precipitação está mais concentrada. Para a realização dos agrupamentos foram escolhidas as variáveis: PCD, PCP, médias da precipitações anuais e médias das precipitações mensais. Posteriormente, foi aplicada a análise de agrupamento para obter grupos com características similares. Os resultados mostraram que as precipitações são melhor distribuídas na região leste do estado, neste caso, os meses mais chuvosos são de maio a agosto. Os municípios localizados nessa área possuem dois picos de chuvas, devido à atuação de dois sistemas: Perturbações Ondulatórias dos Alísios (POA s) e Zona de Convergência Intertropical (ZCIT). Nas regiões localizadas a oeste os meses que possuem maior concentração de chuvas são março e abril, neste caso temos apenas um pico de precipitação, devido a atuação da ZCIT. A identificação de áreas homogêneas favorece o planejamento adequado de acordo com as características de cada grupo formado e o RN pode foi dividido em 4 (quatro) regiões homogêneas. As técnicas de agrupamento utilizadas apresentaram resultados semelhantes, porém, sugere-se o uso de mais de uma técnica para que se possa analisar qual delas reflete melhor a realidade local. O estudo da variabilidade de precipitação, através dos índices estudados e do agrupamento realizado, são ferramentas adequadas ao planejamento ambiental e econômico

Biossíntese e recentes avanços na produção de celulose bacteriana

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Focalização isoelétrica na identificação das hemoglobinas

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Representações espectrais de sistemas complexos: aplicações à síntese de superfícies brownianas fracionárias anisotrópicas, filtragem de sinais e identificação de correlações

In this thesis, we study the application of spectral representations to the solution of problems in seismic exploration, the synthesis of fractal surfaces and the identification of correlations between one-dimensional signals. We apply a new approach, called Wavelet Coherency, to the study of stratigraphic correlation in well log signals, as an attempt to identify layers from the same geological formation, showing that the representation in wavelet space, with introduction of scale domain, can facilitate the process of comparing patterns in geophysical signals. We have introduced a new model for the generation of anisotropic fractional brownian surfaces based on curvelet transform, a new multiscale tool which can be seen as a generalization of the wavelet transform to include the direction component in multidimensional spaces. We have tested our model with a modified version of the Directional Average Method (DAM) to evaluate the anisotropy of fractional brownian surfaces. We also used the directional behavior of the curvelets to attack an important problem in seismic exploration: the atenuation of the ground roll, present in seismograms as a result of surface Rayleigh waves. The techniques employed are effective, leading to sparse representation of the signals, and, consequently, to good resolutions

Análise de polimorfismos dos genes da rota quinureniana em pacientes com meningite bacteriana.

Bacterial meningitis (BM) is still an important infectious disease causing death and disability. Invasive bacterial infections of the central nervous systems (CNS) generate some of the most powerful inflammatory responses known, which contributes to neuronal damage. The DNA microarray technology showed alterations in the kynurenine (KYN) pathway that is induced in BM and other diseases associated with inflammation, leading to brain injury. Our main aim was to search SNPs previously described in the KYN path enzymes to investigate a putative association of this SNPs with imbalanced in this pathway in patients with BM. The patients included in this study were 33 males and 24 females, with ages varying from 02 months to 68 years. SNPs were located inside of the domain conserved in KYNU, IDO, KATI and KATII. Primers were designed for analysis of SNPs already described by PIRA-PCR followed by RFLP. The analysis of KYNU+715G/A SNP found a heterozygous frequency of 0.033. We did not found the variant allele of SNP KYNU+693G/A, KATI+164T/C, KATII+650C/T and IDO+434T/G. Despite of previews studies showing the importance of KYN pathway we did not found one association of these SNPs analyzed with susceptibility or severity of MB in study population.

Associação entre polimorfismos em enzimas de reparo de DNA e ocorrência de meningite bacteriana.

Despite advances in vaccine development and therapy, bacterial meningitis (BM) remains a major cause of death and long-term neurological disabilities. As part of the host inflammatory response to the invading pathogen, factors such as reactive oxygen species are generated, which may damage DNA and trigger the overactivation of DNA repair mechanisms. It is conceivable that the individual susceptibility and outcome of BM may be in part determined by non synonymous polymorphisms that may alter the function of crucial BER DNA repair enzymes as PARP-1, OGG-1 and APE-1. These enzymes, in addition to their important DNA repair function, also perform role of inflammatory regulators. In this work was investigated the non synonymous SNPs APE-1 Asn148Glu, OGG-1 Ser326Cys,PARP-1 Val762Ala, PARP-1 Pro882Leu and PARP-1 Cys908Tyr in patients with bacterial meningitis (BM), chronic meningitis (CM), aseptic meningitis (AM) and not infected (controls). As results we found increased frequency of variant alleles of PARP-1 Val762Ala (P = 0.005) and APE-1 Asn148Glu (P=0.018) in BM patients, APE-1 Asn148Glu in AM patients (P = 0.012) and decrease in the frequency of the variant allele OGG-1 Ser326Cys in patients with CM (P = 0.013), regarding the allelic frequencies in the controls. A major incidence of individuals heterozygous and/ or polymorphic homozygous in BM for PARP-1 Val762Ala (P= 0.0399, OD 4.2, 95% IC 1.213 -14.545) and PARP-1 Val762Ala/ APE-1 Asn148Glu (P = 0.0238, OD 11.111, 95% IC 1.274 - 96.914) was observed related to what was expected in a not infected population. It was also observed a major incidence of combined SNPs in the BM patients compared with the control group (P=0.0281), giving evidences that SNPs can cause some susceptibility to the disease. This combined effect of SNPs seems to regulate the principal cytokines and other factors related to BM inflammatory response and point the importance of DNA repair not only to repair activity when DNA is damaged, but to others essential functions to human organism balance.

Ativação local da rota da quinurenina por moduladores inflamatórios durante a meningite bacteriana.

Activation of the kynurenine (KYN) pathway (KP) by modulators of immune system has been observed during several neurological diseases. Here we assessed the association of chemo-/cytokine levels with the concentration of KP metabolites in cerebrospinal fluid (CSF) and plasma samples from patients with bacterial meningitis (BM). All samples were collected from 42 patients diagnosed with acute bacterial meningitis (ABM), aseptic meningitis, tuberculous meningitis and patients without infection neurological disorders. CSF and plasma concentration of metabolites from the KP was assessed by high pressure liquid chromatography (HPLC) and cytokines and chemokines by Bio-plex 200 suspension array system. Concentrations of the KP metabolites KYN and kynurenic acid (KYNA) were significantly higher in CSF of patients with ABM compared to other groups. Tryptophan (TRP), anthranilic acid (AA), 3-hydroxykynurenine (3HK) and 3-hydroxyanthranilic acid (3HAA) did not show statistical significance, although some of them presented a good accumulation during ABM. The expression of TNF-alpha, IL-6, IL-1beta, IFN-gamma, IL-10, IL-1 receptor antagonist (IL-1Ra), MIP-1alpha, MIP-1beta, MCP-1 and G-CSF was about 100-fold higher in CSF from ABM patients than other infected groups. In all CSF and plasma samples, the concentration of IL-2, IL-12(p70), IL-4, IL-8 and GM-CSF was not significant. ABM still showed significant concentrations of IL-6, IL-10, IL-1Ra and MCP-1 in plasma samples. Based on the comparison of KP metabolites concentrations between plasma and CSF samples we conclude that the activation of the tryptophan pathway upon BM occurs within the brain. This increase in KP metabolites is most due to activation of the KP by molecules as IFN-gamma and TNF-alpha in response to infection.

Fatores de influência na produção de leite bovino sobre os níveis da contagem bacteriana total

The objective of this study was to evaluate the influence of milking procedures on the levels of total bacterial count (TBC) in bovine milk. In the first study the influences of procedures for hygienic milking, cleaning of milking equipment and milk cooling tanks on the TBC levels were evaluated. Four bulk samples of milk were collected from each tank in eight properties for TBC analysis, employing the flow cytometry method. A questionnaire was applied in each property to assess the current situation of milking procedures on each production system that took part on this research, followed by training of employees in good agricultural practices in the production of milk and monitoring of the TBC measurements. The methodology for analysis of longitudinal data was considered, focusing on random effects models. The results showed that the handling procedures for milking and the cleanliness of the cooling tank contributed to a further reduction in the levels of TBC raw milk cooling tanks. The second study aimed to describe the percentage of the properties that comply with the Normative Instruction Nº 51 (Brazil s IN 51) with regard to total bacterial count (TBC) in bovine milk. The study was conducted from January 2010 to July 2011. Milk samples were collected from the eight properties selected for TBC analysis by the flow cytometry method. Again, on each property a questionnaire was applied to assess the current situation of milking procedures on each production system that took part on this research, followed by training of employees in good agricultural practices in the production of milk and monitoring of the TBC measurements. The methodology of marginal models based on Generalized Estimate Equations (GEEs) was followed in the statistical analysis. The results showed that the handling procedures of the milking and the cleanliness of the cooling tanks contributed to a considerable percentage of the properties that reached the limits of TBC established by IN 51

Papel de sinais cromáticos na identificação de parceiros sexuais em sagüi comum (callithrix jacchus)

The literature concerning color vision shows a trichromatic advantage in detecting ripe fruits and young leaves, but there are contradictory results. There is also the suggestion of this type of vision being adapted to perceive socio-sexual signals. Indeed, Old World primates utilize the skin color of conspecifics as a factor of attraction. But in New World primates there is no record of a coloration signal in the body that can be utilized by other group members. The present study aims to: 1- test whether there is a relation between coloration of body regions and ovulatory cycle in female Callithrix jacchus; 2- Determine if this species uses visual signals to choose mates that are sexually receptive. We collected feces from six females during one month to quantify progesterone concentration by EIA. Body region coloration was measured using a portable spectrometer and modeled to obtain the quantum catch of each photoreceptor, the opponency channels and chromatic distance between the points in units of JND. We recorded the behavior of six males exposed to three pairs of females with a cycling and a non-cycling female in each pair using a transparent plexiglass apparatus. The color of different body regions presented a correlation between progesterone concentration and the yellow-blue and red-green visual axes, with the genitalia as the region showing the highest correlation. The visual axis more apt to see the color variations was the yellow-blue in dichromats, and in trichromats were the red-green to face, yellow-blue to abdomen and both chromatic axes to genitalia. There was no difference in the signal detectability between trichromats and dichromats, but the perception pattern differed between the phenotypes, with a better signal detection by the dichromat phenotype 562 and the trichromat phenotype 543/562. During the behavioral experiments males presented longer gaze duration in periods of experimental manipulation and gaze duration was always longer towards cycling females compared to non-cycling females. Male locomotion during experimental manipulation was greater than in the control only during the periovulatory period of the female, indicating greater excitement. The behavior of cycling females was more active than the behavior of the non-cycling ones regarding locomotion and touching of the plexiglass division of the apparatus. Male gaze duration to cycling females increased with decreasing progesterone concentration, but none of the coloration parameters was correlated to the mate preference exhibited. This coloration signal can transmit information to animals of the group about fertility of female. Different from the intense red of the genitalia swellings of Old World primates, marmoset female genitalia became more bluish-green in the fertile period. Males chose fertile females and were able to visually identify the periovulatory period of females. Choice is related to progesterone concentration, but our results do not show relation between coloration and mate preference. Maybe some behavioral measure is associated with the choice