Apoplastic And Intracellular Plant Sugars Regulate Developmental Transitions In Witches' Broom Disease Of Cacao.

Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation.

Low-level Laser Therapy To The Mouse Femur Enhances The Fungicidal Response Of Neutrophils Against Paracoccidioides Brasiliensis.

Neutrophils (PMN) play a central role in host defense against the neglected fungal infection paracoccidioidomycosis (PCM), which is caused by the dimorphic fungus Paracoccidioides brasiliensis (Pb). PCM is of major importance, especially in Latin America, and its treatment relies on the use of antifungal drugs. However, the course of treatment is lengthy, leading to side effects and even development of fungal resistance. The goal of the study was to use low-level laser therapy (LLLT) to stimulate PMN to fight Pb in vivo. Swiss mice with subcutaneous air pouches were inoculated with a virulent strain of Pb or fungal cell wall components (Zymosan), and then received LLLT (780 nm; 50 mW; 12.5 J/cm2; 30 seconds per point, giving a total energy of 0.5 J per point) on alternate days at two points on each hind leg. The aim was to reach the bone marrow in the femur with light. Non-irradiated animals were used as controls. The number and viability of the PMN that migrated to the inoculation site was assessed, as well as their ability to synthesize proteins, produce reactive oxygen species (ROS) and their fungicidal activity. The highly pure PMN populations obtained after 10 days of infection were also subsequently cultured in the presence of Pb for trials of protein production, evaluation of mitochondrial activity, ROS production and quantification of viable fungi growth. PMN from mice that received LLLT were more active metabolically, had higher fungicidal activity against Pb in vivo and also in vitro. The kinetics of neutrophil protein production also correlated with a more activated state. LLLT may be a safe and non-invasive approach to deal with PCM infection.

In Vivo Determination Of The Volatile Metabolites Of Saprotroph Fungi By Comprehensive Two-dimensional Gas Chromatography.

In this work, we discuss the use of multi-way principal component analysis combined with comprehensive two-dimensional gas chromatography to study the volatile metabolites of the saprophytic fungus Memnoniella sp. isolated in vivo by headspace solid-phase microextraction. This fungus has been identified as having the ability to induce plant resistance against pathogens, possibly through its volatile metabolites. Adequate culture media was inoculated, and its headspace was then sampled with a solid-phase microextraction fiber and chromatographed every 24 h over seven days. The raw chromatogram processing using multi-way principal component analysis allowed the determination of the inoculation period, during which the concentration of volatile metabolites was maximized, as well as the discrimination of the appropriate peaks from the complex culture media background. Several volatile metabolites not previously described in the literature on biocontrol fungi were observed, as well as sesquiterpenes and aliphatic alcohols. These results stress that, due to the complexity of multidimensional chromatographic data, multivariate tools might be mandatory even for apparently trivial tasks, such as the determination of the temporal profile of metabolite production and extinction. However, when compared with conventional gas chromatography, the complex data processing yields a considerable improvement in the information obtained from the samples. This article is protected by copyright. All rights reserved.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Dry eye disease caused by viral infection: review

Dry eye disease and ocular surface disorders may be caused or worsened by viral agents. There are several known and suspected virus associated to ocular surface diseases. The possible pathogenic mechanisms for virus-related dry eye disease are presented herein. This review serves to reinforce the importance of ophthalmologists as one of the healthcare professional able to diagnose a potentially large number of infected patients with high prevalent viral agents.

Quality of sausage elaborated using minced Nile Tilapia submmitted to cold storage

Filleting yield of Nile tilapia Oreochromis niloticus (L.) is low (30%) and generates large amount of wastes that may turn into environmental and economic problem. However, these wastes can be used for the extraction of minced fish (MF) which can be used in the preparation of sausages. The objective of this study was to assess the quality of sausages prepared with 0, 20, 40, 60, 80 and 100% of MF from Nile tilapia filleting waste during storage at 0±0.3ºC. Alterations in the instrumental color (L*, a* and b*), lipid oxidation (TBARS), total volatile nitrogenous bases (TVB-N), pH, microbiological condition (pathogenic bacteria and aerobic psychrotrophic bacteria), and sensory attributes (color, odor, flavor, texture and overall acceptability) were evaluated for up to 40 days. The addition of MF to sausages increased TBARS values and decreases TVB-N, L*, a* and b* values. Acceptability of color attribute decreased with increasing MF; best flavor, texture and overall acceptability scores were registered for sausages containing 40 and 60% MF; best odor was registered for 100% MF. Pathogenic microorganisms were not detected, but decrease in pH and proliferation of aerobic psychrotrophic bacteria which, however, did not compromise sensory evaluation of sausages were registered throughout storage. Sausages prepared with MF from tilapia filleting waste have a shelf-life of 40 days when stored at 0±0.3ºC, and the maximum recommended MF inclusion to maintain good sensory quality is 60%.

Influência da luminosidade e da camada de cera epicuticular de superfícies de folhas de soja na infecção de Phakopsora pachyrhizi

A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primeiro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies.

A multi-screening approach for marine-derived fungal metabolites and the isolation of cyclodepsipeptides from Beauveria felina

Extracts obtained from 57 marine-derived fungal strains were analyzed by HPLC-PDA, TLC and ¹H NMR. The analyses showed that the growth conditions affected the chemical profile of crude extracts. Furthermore, the majority of fungal strains which produced either bioactive of chemically distinctive crude extracts have been isolated from sediments or marine algae. The chemical investigation of the antimycobacterial and cytotoxic crude extract obtained from two strains of the fungus Beauveria felina have yielded cyclodepsipeptides related to destruxins. The present approach constitutes a valuable tool for the selection of fungal strains that produce chemically interesting or biologically active secondary metabolites.

Genotype-phenotype correlation in Brazillian Rett syndrome patients

BACKGROUND: Rett syndrome (RS) is a severe neurodevelopmental X-linked dominant disorder caused by mutations in the MECP2 gene. PURPOSE: To search for point mutations on the MECP2 gene and to establish a correlation between the main point mutations found and the phenotype. METHOD: Clinical evaluation of 105 patients, following a standard protocol. Detection of point mutations on the MECP2 gene was performed on peripheral blood DNA by sequencing the coding region of the gene. RESULTS: Classical RS was seen in 68% of the patients. Pathogenic point mutations were found in 64.1% of all patients and in 70.42% of those with the classical phenotype. Four new sequence variations were found, and their nature suggests patogenicity. Genotype-phenotype correlations were performed. CONCLUSION: Detailed clinical descriptions and identification of the underlying genetic alterations of this Brazilian RS population add to our knowledge of genotype/phenotype correlations, guiding the implementation of mutation searching programs.

Experimental infections with Paracoccidioides brasiliensis obtained from armadillos: comparison to clinical isolates

Paracoccidioides brasiliensis causes paracoccidioidomycosis (PCM) that is one of the most prevalent systemic human mycoses in Latin America. Armadillos show a high incidence of PCM infection and could, therefore, be a natural reservoir for this fungus. In this study were compared the virulence profiles of isolates obtained from nine-banded armadillos (Dasypus novemcinctus) (PbT1 and PbT4) and isolates from PCM patients (Pb265 and Bt83). Pathogenicity was evaluated by fungal load and analysis of colony morphology. Immunity against the fungus was tested by delayed type hypersensitivity test (DTH) and antibody quantification by ELISA. The higher virulence of PbT1 and PbT4 was suggested by higher fungal load in spleen and lungs. Armadillo isolates and Bt83 presented a cotton-like surface contrasting with the cerebriform appearance of Pb265. All isolates induced cellular and humoral immune responses in infected BALB/c mice. DTH reactions were similarly induced by the four isolates, however, a great variability was observed in specific antibody levels, being the highest ones induced by Bt83 and PbT4. The present work confirms that armadillos harbor P. brasiliensis, whose multiplication and induced immunity in experimentally infected mice are heterogeneous, resembling the behavior of isolates from human PCM. This study reinforces the possibility that armadillos play an important role in the biological cycle of this pathogen.

Acompanhamento químico da vermicompostagem de lodo de esgoto doméstico

This research aims to monitor the humification process of domestic sewage sludge resulted from the vermicomposting, evaluating, also, the possibility of using the final product (vermicompost) in agricultural soils. The monitored chemical variables during the 90 days of vermicomposting were: humidity rate, organic matter content, nitrogen and phosphorus content, pathogenic organisms concentration, total organic carbon, acidity, CEC, C/N ratio, CEC/TOC ratio, and humic and fulvic acids content. The change in these variables during the vermicomposting process showed that this technique is effective for use in the maturation of the residue.

Screening for antifungal activities of extracts of the brazilian seaweed genus Laurencia (Ceramiales, Rhodophyta)

The resistance of pathogens to commonly used antibiotics has enhanced morbidity and mortality and has triggered the search for new drugs. Several species of the red alga genus Laurencia are very interesting candidates as potential sources of natural products with pharmaceutical activity because they are known to produce a wide range of chemically interesting halogenated secondary metabolites. This is an initial report of the antifungal activities of the secondary metabolites of five species of Laurencia, collected in the state of Espírito Santo, against three strains of pathogenic fungi: Candida albicans (CA), Candida parapsilosis (CP), and Cryptococcus neoformans (CN). Minimum inhibitory concentrations (MIC) of the algal extracts were determined by serial dilution method in RPMI 1640 Medium in 96-well plates according to the NCCLS and microbial growth was determined by absorbance at 492nm. A result showing maintenance or reduction of the inoculum was defined as fungistatic, while fungicidal action was no observed growth in the 10 µL fungistatic samples subcultured in Sabouraud Agar. Our results indicate that apolar extracts of Laurencia species possess antifungal properties and encourage continued research to find new drugs for therapy of infectious diseases in these algae.

Larva of Atractocerus Brasiliensis (Lepeletier & Audinet-Serville, 1825) (Lymexylidae, Atractocerinae)

The larva of Atractocerus brasiliensis (Lepeletier & Audinet-Serville, 1825), collected for the first time in Pinus oocarpa Schiede ex Schltdl. (Pinaceae) is described and illustrated. Until now, for Lymexylidae, only the larva of Melittomma sp. (Melittomminae) was known from the neotropical region (Brazil). Biological notes, a comparison with the description of A. brevicornis, the type-species of the genus (recorded from Africa and Madagascar), and history of the known lymexylid larvae are also included.

Impactos na saúde das deficiências de acesso a água

O acesso regular à água potável e segura tem causado preocupação, principalmente em países em desenvolvimento e, mais enfaticamente em áreas periurbanas, que abrigam a população socialmente excluída. O objetivo deste trabalho é abordar questões de acesso à água em regiões periurbanas e para tanto foi realizado levantamento bibliográfico nas bases de dados Pubmed, Medline e SciELO assim como relatórios da OMS, OPAS, IBGE e Ministério das Cidades. A falta ou a precariedade do acesso à água representa situação de risco que propicia aumento da incidência de doenças infecciosas agudas e da prevalência de doenças crônicas. O estabelecimento do grau de acesso à água de qualidade considera fatores como distância e tempo percorrido até a fonte de água, volume coletado, demanda atendida e nível de prioridade de ações de intervenção. Na qualidade da água, consideram-se como fatores de impacto o manuseio - maneira como ocorre a coleta, o transporte, o armazenamento e o uso -, a presença de patógenos nas fontes e as práticas rotineiras da população. A determinação da presença de patógenos nas fontes evidencia o risco à saúde e a identificação do agente etiológico indica a origem da contaminação. O caminho para reverter esse cenário é a implementação integrada de políticas públicas de gestão, que envolvam ações conjuntas e ajustadas nos setores de desenvolvimento urbano, habitação, saneamento e saúde e que visem à promoção e à proteção da saúde da população local e ao enfrentamento da complexidade de fatores que evidenciam sua vulnerabilidade.

Pathogenicity of different rabies virus isolates and protection test in vaccinated mice

This study was aimed to evaluate and compare the pathogenicity of rabies virus isolated from bats and dogs, and to verify the efficacy of a commercial rabies vaccine against these isolates. For evaluation of pathogenicity, mice were inoculated by the intramuscular route (IM) with 500MICLD50/0.03mL of the viruses. The cross-protection test was performed by vaccinating groups of mice by the subcutaneous route and challenged through the intracerebral (IC) route. Isolates were fully pathogenic when inoculated by the IC route. When inoculated intramuscularly, the pathogenicity observed showed different death rates: 60.0% for the Desmodus rotundus isolate; 50.0% for dog and Nyctinomops laticaudatus isolates; 40.0% for Artibeus lituratus isolate; 9.5% Molossus molossus isolate; and 5.2% for the Eptesicus furinalis isolate. Mice receiving two doses of the vaccine and challenged by the IC route with the isolates were fully protected. Mice receiving only one dose of vaccine were partially protected against the dog isolate. The isolates from bats were pathogenic by the IC route in mice. However, when inoculated through the intramuscular route, the same isolates were found with different degrees of pathogenicity. The results of this work suggest that a commercial vaccine protects mice from infection with bat rabies virus isolates, in addition to a canine rabies virus isolate.