Folhas verdes, folhas secas, fibra do colmo e a clarificação do caldo de cana-de-açúcar

The presence of vegetal impurities in sugarcane delivered to sugarmills as green and dry leaves is a problem not only because they are non-value materials to be processed along with sugarcane stalks, but also because they can rise the color of the clarified juice and, consequently, the color of the sugar produced, with a reduction of its quality for the market. Another problem is the mud volume sedimented in the clarifiers, which also can result in a larger recirculation and greater volume of filtrate juice, with higher losses of sucrose and utilization of the vacuum rotary filters. The objective of this work was to observe the effect of the presence of green and dry leaves on sugarcane juice clarification, related to a control treatment with the addition of fiber extracted from the stalks. The experiments were planned based on the addition of quantities of fibrous sources in order to formulate samples with absolute increase of 0.25 , 0.50 and 0.75 percentual points over the fiber content of the sugarcane stalks (control treatment). The juice clarification was conducted with a laboratory clarifier. The clarified juice color and the mud volume were evaluated. The presence of green leaves caused higher color and mud volume due to the extraction of non-sucrose components of the leaves. Soluble compounds of dry leaves were also extracted, though not detected by juice analysis. The addition of the fiber extracted from the stalks did not induce alterations in the clarification process.

Inibidor da ação do etileno na conservação pós-colheita de Chrysanthemum morifolium Ramat cv. Dragon

The durability and postharvest quality of cut flowers are fundamental attributes in value along the production chain and in consumer satisfaction. The objective of this study was to evaluate the effect of chemical inhibitors of ethylene action on maintaining the postharvest quality of chrysanthemum stems (Chrysanthemum morifolium Ramat cv. Dragon). The experiment tested maintenance solutions with silver thiosulfate (STS) under five levels (distilled water, a 0.2 mM STS, the STS 0.2 mM + sucrose at 50 g L-1, STS at 0.4 mM; STS at 0.4 mM + sucrose at 50 g L-1), and date of sampling, for three levels (0, 3, 6 days). Three replications with two flower stems in each treatment were used in the experiment. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, flower color, and number of buds, open flowers and partially open flowers. Treatment with 0.2 mM STS resulted in better maintenance of fresh mass of stems. The concentration of pigments and reducing sugar was higher in those treatments in which sucrose was associated. The color and relative water content were favored in treatments STS 0.2 mM and 0.4 mM. The concentration of 0.2 mM STS obtained the best results, prolonging the vase life the stems. The quality of these stems was higher, with the best assessments of water content, color and turgidity.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Impacto das atividades fisicas nos indicadores de saude de sujeitos adultos : programa mexa-se

Universidade Estadual de Campinas . Faculdade de Educação Física

Suplementação com caldo de cana de açucar comparado com outros carboidratos na reposição do glicogenio e cinetica de biomarcadores pos-exercicio agudo em ratos

Universidade Estadual de Campinas . Faculdade de Educação Física

Scanning electron microscopic study of the in situ effect of salivary stimulation on erosion and abrasion in human and bovine enamel

This in situ study investigated, using scanning electron microscopy, the effect of stimulated saliva on the enamel surface of bovine and human substrates submitted to erosion followed by brushing abrasion immediately or after one hour. During 2 experimental 7-day crossover phases, 9 previously selected volunteers wore intraoral palatal devices, with 12 enamel specimens (6 human and 6 bovine). In the first phase, the volunteers immersed the device for 5 minutes in 150 ml of a cola drink, 4 times a day (8h00, 12h00, 16h00 and 20h00). Immediately after the immersions, no treatment was performed in 4 specimens (ERO), 4 other specimens were immediately brushed (0 min) using a fluoride dentifrice and the device was replaced into the mouth. After 60 min, the other 4 specimens were brushed. In the second phase, the procedures were repeated but, after the immersions, the volunteers stimulated the salivary flow rate by chewing a sugar-free gum for 30 min. Enamel superficial alterations of all specimens were then evaluated using a scanning electron microscope. Enamel prism core dissolution was seen on the surfaces submitted to erosion, while on those submitted to erosion and to abrasion (both at 0 and 60 min) a more homogeneous enamel surface was observed, probably due to the removal of the altered superficial prism layer. For all the other variables - enamel substrate and salivary stimulation -, the microscopic pattern of the enamel specimens was similar.

Oral findings and dental care in a patient with myelomeningocele: case report of a 3-year-old child

Myelomeningocele (MMC) is a congenital malformation of the neural tube that occurs in the first weeks of pregnancy. This malformation refers to the caudal non-closure of the neural tube and neural tissue exposure, which lead to neurological problems, such as hydrocephalus, motor disability, genitourinary tract and skeletal abnormalities and mental retardation. Patients with MMC have an acknowledged predisposition to latex allergy and are usually at a high caries risk and activity due to poor oral hygiene, fermentable carbon hydrate-rich diet and prolonged use of sugar-containing medications. This paper addresses the common oral findings in pediatric patients with MMC, discusses the strategies and precautions to deal with these individuals and reports the dental care to a young child diagnosed with this condition.

Prevalence of mutans streptococci isolated from complete dentures and their susceptibility to mouthrinses

The aims of this study were to evaluate the incidence of mutans streptococci (MS - sessile form) on complete maxillary dentures after use of a specific denture paste, and to determine the minimum inhibitory concentration (MIC) and maximum inhibitory dilution (MID) of 3 oral mouthrinses: Cepacol, Plax and Periogard. Seventy-seven complete denture wearers were randomly assigned into 2 groups, according to the product used for denture cleaning: Control group - conventional dentifrice (Kolynos-Super White); and Test group: experimental denture cleaning paste. Denture biofilm was collected at baseline and after 90 and 180 days after treatment by brushing the dentures with saline solution. After decimal serial dilution, samples were seeded onto agar sucrose bacitracin to count colonies with morphological characteristics of MS. MS identification was performed by the sugar fermentation tests. After this procedure, brain heart infusion broth (BHI) was added to oral mouthrinses (Plax, Cepacol e Periogard) and seeded on Petri dishes. The colonies were seeded using the Steers multiplier and, after the incubation, the MIC and MID of the mouthrinses were calculated. The results showed an incidence of 74.0% (n=57) of MS in the 77 complete dentures examined in the study, being 76.3% (n=29) of the Control group (conventional dentifrice) and 71.8% (28) of the Test group (experimental denture cleaning paste). In both groups, the number of positive cases for MS decreased from day 0 to day 180. In the Test group there was a slight decrease in the incidence of Streptococcus mutans 90 days after use of the experimental denture cleaning paste, which was not observed in the Control group. As regards to mouthrinses, for both groups, Periogard showed antimicrobial action with the highest dilution, followed by Cepacol and Plax. In conclusion, the incidence of MS in complete dentures was high and Periogard was the mouthrinse with the strongest antimicrobial action against MS. The experimental denture cleaning paste showed a slight action against S. mutans after 90 days of treatment.

Estudo comparativo de algumas propriedades dinâmicas de líquidos e grãos na sala de aula

Visando entender as diferenças entre as propriedades dinâmicas dos materiais granulares e as propriedades dinâmicas dos líquidos, foram realizados experimentos usando água e grãos de arroz e açúcar. Os experimentos requerem poucos recursos e foram pensados para que possam ser desenvolvidos com facilidade na sala de aula ou num laboratório de ensino. Os resultados mostraram que o fluxo de grãos difere significativamente do fluxo de líquidos.

Metabolismo mineral em bubalinos com ingestões de diferentes níveis de fósforo

Objetivou-se avaliar os efeitos da ingestão diária de quatro níveis de fósforo (8, 12, 15 e 18 g) sobre o metabolismo de macrominerais (P, Ca, Mg, Na, K e S), incluindo a ingestão, a concentração no rúmen, a taxa de passagem do líquido ruminal, a excreção nas fezes e a disponibilidade aparente. Utilizaram-se quatro bubalinos adultos com fístulas ruminais em delineamento quadrado latino (4 × 4) com dieta total constituída de cana-de-açúcar como volumoso (85%) e concentrado formulado com um dos níveis de fósforo. Os níveis de fósforo não ocasionaram diferença significativa na concentração mineral no rúmen de nenhum mineral estudado. A concentração média de fósforo no conteúdo ruminal foi de 0,98% na matéria seca, enquanto o teor de fósforo nas rações variou de 0,12 a 0,34%, comprovando alta reciclagem de fósforo pela saliva. Níveis crescentes de fósforo na dieta, variando de 8 a 18 g/animal/dia, não influenciam as disponibilidades de cálcio e magnésio. Com o nível de fósforo de 15 g/dia, houve melhor utilização do fósforo da dieta. A ingestão de níveis crescentes de fósforo em g/kg0,75 (X) promoveu aumento linear na excreção fecal desse mineral em g/kg0,75 (Y) e baixos valores de disponibilidade do fósforo, que pode ser estimado pela equação Y = 0,03 + 0,610X, o que indica deficiência desse elemento mineral na dieta para o metabolismo animal.

Effects of dietary energy and nitrogen supplements on rumen fermentation and protozoa population in buffalo and zebu cattle

The effects were assessed of two energy sources in concentrate (ground grain corn vs. citrus pulp) and two nitrogen sources (soybean meal vs. urea) on rumen metabolism in four buffaloes and four zebu cattle (Nellore) with rumen cannula and fed in a 4 × 4 Latin square design with feeds containing 60% sugar cane. Energy supplements had no effect on the rumen ammonia concentration in cattle, but ground grain corn promoted higher ammonia level than citrus pulp in buffalo. Urea produced higher ammonia level than soybean meal in both animal species. On average, the buffaloes maintained a lower rumen ammonia concentration (11.7 mg/dL) than the cattle (14.5 mg/dL). Buffaloes had lower production of acetic acid than cattle (58.7 vs. 61.6 mol/100 mol) and higher of propionic acid (27.4 vs. 23.6 mol/100 mol). There was no difference in the butyric acid production between the buffaloes (13.6 mol/100 mol) and cattle (14.8 mol/100 mol) and neither in the total volatile fatty acids concentration (82.5 vs. 83.6 mM, respectively). The energy or nitrogen sources had no effect on rumen protozoa count in either animal species. The zebu cattle had higher rumen protozoa population (8.8 × 10(5)/mL) than the buffaloes (6.1 × 10(5)/mL). The rumen protozoa population differed between the animal species, except for Dasytricha and Charonina. The buffaloes had a lower Entodinium population than the cattle (61.0 vs 84.9%, respectively) and a greater percentage of species belonging to the Diplodiniinae subfamily than the cattle (28.6 vs. 1.4%, respectively). In cattle, ground corn is a better energy source than citrus pulp for use by Entodinium and Diplodiniinae. In the buffaloes, the Entodinium are favored by urea and Diplodiniinae species by soybean meal.

Utilização de levedura íntegra e seus derivados em dietas para juvenis de tilápia do Nilo

Neste trabalho, avaliou-se a adição de células íntegras de levedura e seus derivados em dietas para juvenis de tilápia do Nilo. Foram utilizados 144 juvenis machos de tilápia (peso médio de 52,1g) distribuídos em 12 tanques de fibra de vidro (250L), em delineamento inteiramente casualizado, composto por quatro tratamentos e três repetições. Os peixes foram alimentados ad libitum, duas vezes ao dia durante 60 dias, com dietas isoproteicas (28% PB) e isocalóricas (2.900kcal de ED kg-1) contendo levedura íntegra de cana-de-açúcar (LI), levedura autolisada (LA) e parede celular (PC) adicionados na proporção de 25% da proteína bruta total, comparadas com uma dieta controle (CO), sem adição de levedura. Não foram observadas diferenças significativas para conversão alimentar aparente e taxa de eficiência protéica. No entanto, o ganho em peso foi melhor nos peixes alimentados com as dietas LA (114,70g) e PC (131,03g), assim como em relação à taxa de crescimento específico (LA=1,79 e PC=1,93%), à proteína bruta no ganho de peso (LA=14,45 e PC=15,62%) e ao conteúdo corporal proteico (LA=14,89 e PC=15,67g 100g-1). As frações, a parede celular e a levedura autolisada de cana-de-açúcar podem ser utilizadas em dietas para juvenis de tilápia.

Albedo à superfície a partir de imagens Landsat 5 em áreas de cana-de-açúcar e cerrado

Propôs-se, neste trabalho, estimar dados de albedo à superfície terrestre usando-se o sensor Thematic Mapper (TM) do satélite LANDSAT 5 e compará-lo com dados de duas estações agrometeorológicas localizadas em região de Cerrado e a outra em cultivo da cana-de-açúcar. A região de estudo está localizada no município de Santa Rita do Passa Quatro, SP, Brasil. Para a realização do estudo obtiveram-se seis imagens orbitais do satélite Landsat 5 sensores TM, na órbita 220 e ponto 75, nas datas de 22/02, 11/04, 29/05, 01/08, 17/08 e 21/11, todas do ano de 2005, a que correspondem os dias juliano de 53, 101, 149, 213, 229 e 325, respectivamente. As correções geométricas para as imagens foram realizadas e geradas as cartas de albedo. O algoritmo SEBAL estimou satisfatoriamente os valores de albedo de superfícies sobre áreas de cerrado e de cana-de-açúcar, na região de Santa Rita do Passa Quatro, SP, consistentes com observações realizadas do albedo à superfície.

Consumo alimentar e ecologia de populações ribeirinhas em dois ecossistemas amazônicos: um estudo comparativo

OBJETIVO: Este artigo analisa e compara os dados de consumo alimentar de duas populações ribeirinhas da Amazônia vivendo em ecossistemas contrastantes de floresta tropical: a várzea estacional e a floresta de terra firme. MÉTODOS: Foi estudado o consumo alimentar de 11 unidades domésticas na várzea (Ilha de Ituqui, Município de Santarém) e 17 na terra firme (Floresta Nacional de Caxiuanã, Municípios de Melgaço e Portel). O método utilizado foi o recordatório de 24 horas. As análises estatísticas foram executadas com o auxílio do programa Statistical Package for Social Sciences 12.0. RESULTADOS: Em ambos os ecossistemas, os resultados confirmam a centralidade do pescado e da mandioca na dieta local. Porém, a contribuição de outros itens alimentares secundários, tais como o açaí (em Caxiuanã) e o leite in natura (em Ituqui), também foi significante. Além disso, o açúcar revelou ser uma fonte de energia confiável para enfrentar as flutuações sazonais dos recursos naturais. Parece haver ainda uma maior contribuição energética dos peixes para a dieta de Ituqui, provavelmente em função da maior produtividade dos rios e lagos da várzea em relação à terra firme. Por fim, Ituqui revelou uma maior dependência de itens alimentares comprados, enquanto Caxiuanã mostrou estar ainda bastante vinculada à agricultura e às redes locais de troca. CONCLUSÃO: Além dos resultados confirmarem a importância do pescado e da mandioca, também mostraram que produtos industrializados, como o açúcar, têm um papel importante nas dietas, podendo apontar para tendências no consumo alimentar relacionadas com a atual transição nutricional e com a erosão, em diferentes níveis, dos sistemas de subsistência locais.

Genotype-phenotype correlation in Brazillian Rett syndrome patients

BACKGROUND: Rett syndrome (RS) is a severe neurodevelopmental X-linked dominant disorder caused by mutations in the MECP2 gene. PURPOSE: To search for point mutations on the MECP2 gene and to establish a correlation between the main point mutations found and the phenotype. METHOD: Clinical evaluation of 105 patients, following a standard protocol. Detection of point mutations on the MECP2 gene was performed on peripheral blood DNA by sequencing the coding region of the gene. RESULTS: Classical RS was seen in 68% of the patients. Pathogenic point mutations were found in 64.1% of all patients and in 70.42% of those with the classical phenotype. Four new sequence variations were found, and their nature suggests patogenicity. Genotype-phenotype correlations were performed. CONCLUSION: Detailed clinical descriptions and identification of the underlying genetic alterations of this Brazilian RS population add to our knowledge of genotype/phenotype correlations, guiding the implementation of mutation searching programs.