941 resultados para formation process


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Annatto seeds do not germinate during early stages of their development because of insufficient reserve substances. In situ analysis showed that the principal reserves are proteins and starch, deposited in endosperm cells. During the early stages of development, the starch grains were elliptic, because amylose was the minor component. During development, these grains became more spherical due to an increase in amylose relative to amylopectin. Endosperm cells do not contain protein bodies, but they accumulate proteins dispersed in the cytoplasm. At the final stage of development the proteins became compacted due to the dehydration of the seeds wich is part of the global process of orthodox seeds maturation. Natural fluorescence revealed aromatic amino acids, principally tryptophan and tyrosine in the proteins. The seeds reached their maximum dry weight after moisture contents had declined to around 60%. At this point the seeds presented maximum germination capacity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Concept formation depends on language and thought, that promote the integration of information coming from the senses. It is postulated that changes in the person, the objects and events to be known suggest flexible models of concept teaching. It is assumed that the same considerations apply to teaching concepts to blind pupils. Specificities of this process are discussed, including the role of touch as resource, although not as a direct substitute to vision, and the notion of representation as a basis for the elaboration of pedagogical resources for the blind student.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper discusses theoretical results of the research project Linguistic Identity and Identification: A Study of Functions of Second Language in Enunciating Subject Constitution. Non-cognitive factors that have a crucial incidence in the degree of success and ways of accomplishment of second language acquisition process are focused. A transdisciplinary perspective is adopted, mobilising categories from Discourse Analysis and Psychoanalysis. The most relevant ones are: discursive formation, intradiscourse, interdiscourse, forgetting n° 1, forgetting n° 2 (Pêcheux, 1982), identity, identification (Freud, 1966; Lacan, 1977; Nasio, 1995). Revuz s views (1991) are discussed. Her main claim is that during the process of learning a foreign language, the foundations of psychical structure, and consequently first language, are required. After examining how nomination and predication processes work in first and second languages, components of identity and identification processes are focused on, in an attempt to show how second language acquisition strategies depend on them. It is stated that methodological affairs of language teaching, learner s explicit motivation and the like are subordinated to the comprehension of deeper non-cognitive factors that determine the accomplishment of the second language acquisition process. It is also pointed out that those factors are to be approached, questioning the bipolar biological-social conception of subjectivity in the study of language acquisition and use and including in the analysis symbolic and significant dimensions of the discourse constitution process.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The theme of human formation is at the centre of the philosophy of education, whose aim is precisely the process of human promotion brought about by education. Starting from the critical vigilance proper to philosophy, the text sketches a phenomenology of the present time, verifying that the ideas prevailing in education at present are centred on the critique of reason and on the notions of truth and objectivity. This neo-pragmatism, which in the attempt to oppose metaphysics becomes deeply metaphysical, reducing everything to language, is contested by the authors with Marx's thoughts as a historicising philosophy that concerns not abstract subjects, but real individuals, historical subjects that are constituted as a synthesis of social relations. To that end, the authors resort to the historical ontological reflection on human formation contained in Marx's Economic and Philosophical Manuscripts of 1844. The article concludes by defending the proposition that access to the classics is a necessary condition for human formation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The copolymer poly (L-co-D,L lactic acid), PLDLA, has gained prominence in the field of temporary prostheses due to the fact that their time of degradation is quite compatible with the requirement in the case of osseous fracture. In this work the in vivo degradation of devices from copolymer, as a system of plates and screws, used in fixation of the tibia of rabbits was studied. The devices were implanted in 15 adult rabbits, albinos, New Zealand race, and they were used as control devices of alloys of titanium (Ti-6Al-4V/ V grade). The use of copolymers, synthesized in the laboratory, was tested in the repair of fracture in rabbits'tibias, being assessed in the following times: 2 weeks, 2 months and 3 months. Morphological analysis of tissue surrounding the plate and screw system, for 2 weeks of implantation, showed the presence of osteoblasts, indicating a pre bone formation. After 2 months there was new bone formation in the region in contact with the polymer. This bone growth occurred simultaneously with the process of PLDLA degradation, invading the region where there was polymer and after 3 months there was an intense degradation of the copolymer and hence greater tissue invasion compared to 2 months which characterized bone formation in a region where the polymer degraded. The in vivo degradation study of the devices for PLDLA by means of histological evaluations during the period of consolidation of the fracture showed the efficiency of plate and screw system, and it was possible to check formation of bone tissue at the implantation site, without the presence of inflammatory reaction

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física