990 resultados para Gene Induction
Resumo:
Purpose: To identify papillary thyroid carcinoma (PTC)-associated transcripts, we compared the gene expression profiles of three Serial Analysis of Gene Expression libraries generated from thyroid tumors and a normal thyroid tissue. Experimental Design: Selected transcripts were validated in a panel of 57 thyroid tumors using quantitative PCR (qPCR). An independent set of 71 paraffin-embedded sections was used for validation using immunohistochemical analysis. To determine if PTC-associated gene expression could predict lymph node involvement, a separate cohort of 130 primary PTC (54 metastatic and 76 nonmetastatic) was investigated. The BRAF(V600E) mutational status was compared with qPCR data to identify genes that might be regulated by abnormal BRAF/MEK/extracellular signal-regulated kinase signaling. Results: We identified and validated new PTC-associated transcripts. Three genes (CST6, CXCL14, and DHRS3) are strongly associated with PTC. Immunohistochemical analysis of CXCL14 confirmed the qPCR data and showed protein expression in PTC epithelial cells. We also observed that CST6, CXCL14, DHRS3, and SPP1 were associated with PTC lymph node metastasis, with CST6, CXCL14, and SPP1 being positively correlated with metastasis and DHRS3 being negatively correlated. Finally, we found a strong correlation between CST6 and CXCL14 expression and BRAF(V600E) mutational status, suggesting that these genes may be induced subsequently to BRAF activation and therefore may be downstream in the BRAF/MEK/extracellular signal-regulated kinase signaling pathway. Conclusion: CST6, CXCL14, DHRS3, and SPP1 may play a role in PTC pathogenesis and progression and are possible molecular targets for FTC therapy.
Resumo:
Context: 21-hydroxylase deficiency (21OHD) is a common genetic disorder caused by mutations in the CYP21A2 gene, which encodes the adrenal 21-hydroxylase, microsomal P450c21. CYP21A2 gene mutations generally correlate well with impaired P450c21 enzymatic activity and the clinical findings in 21OHD, but occasional discrepancies between genotype and phenotype suggest the effects of modifier genes. Mutations in P450 oxidoreductase (POR), the protein that transfers electrons from reduced nicotinamide adenine dinucleotide phosphate to all microsomal P450s, can ameliorate the 21OHD phenotype and, therefore, could be a modifier gene. Objectives: We sought to identify POR variants in patients with 21OHD having discordant phenotype and genotype, and to evaluate their effect on 21-hydroxylase activity. Patients and Methods: We determined the CYP21A2 genotypes of 313 Brazilian patients with 21OHD and correlated the genotype and phenotype. The POR gene was sequenced in 17 patients with discordant genotype and phenotype. Wild-type and A503V POR, and P450c21 were expressed in bacteria and reconstituted in vitro. Activities were assayed by conversion of [C-14] progesterone to deoxycorticosterone and [H-3]17-hydroxyprogesterone to 11-deoxycortisol, and assessed by thin layer chromatography and phosphorimaging. Results: The A503V POR variant was found in 10 of 30 alleles, the same ratio as in the normal population. There were no significant differences in Michaelis constant, maximum velocity and maximum velocity/Michaelis constant of 21-hydroxylase activity supported by wild-type and A503V POR. Conclusion: The only POR missense polymorphism found in atypical 21OHD patients was A503V. Although A503V reduces P450c17 enzymatic activity, it does not influence P450c21 activity, indicating that POR A503V does not modify the 21OHD phenotype.
Resumo:
Wolcott-Rallison syndrome (WRS, OMIM 226980) is a rare autosomal recessive disorder characterized by permanent neonatal diabetes mellitus, epiphyseal dysplasia, and other multisystemic clinical manifestations. We described two novel mutations in the EIF2AK3 gene in two consanguineous families with WRS from Brazil and Morocco. We have observed in case 1 a homozygous C > T replacement at base pair c.1192 at exon 7, generating a stop codon at position 398 (Gln398Stop). Both of his parents were found to be heterozygous for the mutation. We detected in both parents of case 2, a deceased Moroccan girl, a duplication of base pair c.851A at exon 5 (c.851dupA) leading to a frameshift and a stop codon at position 285 (p.Pro285AlafsX3). Both cases 1 and 2 had neonatal diabetes mellitus, multiple epiphyseal dysplasia, and growth delay, and presented episodes of acute hepatic dysfunction. Case 1 presented central hypothyroidism, developmental delay, and mild mental retardation. Case 2 presented a fatal episode of acute renal failure. The clinical phenotype associated with the syndrome can be variable, but a combination of infancy-onset diabetes mellitus, multiple epiphyseal dysplasia, and hepatic and/or renal dysfunction is the mainstay of diagnosis.
Resumo:
N-Acetylglucosamine (GlcNAc) is the major immunoepitope of group A streptococcal cell wall carbohydrates. Antistreptococcal antibodies cross-reactive with anti-GlcNAc and laminin are present in sera of patients with rheumatic fever. The cross-reactivity of these antibodies with human heart valvular endothelium and the underlying basement membrane has been suggested to be a possible cause of immune-mediated valve lesion. Mannose-binding lectin (MBL) encoded by the MBL2 gene, a soluble pathogen recognition receptor, has high affinity for GlcNAc. We postulated that mutations in exon 1 of the MBL2 gene associated with a deficient serum level of MBL may contribute to chronic severe aortic regurgitation (AR) of rheumatic etiology. We studied 90 patients with severe chronic AR of rheumatic etiology and 281 healthy controls (HC) for the variants of the MBL2 gene at codons 52, 54, and 57 by using a PCR-restriction fragment length polymorphism-based method. We observed a significant difference in the prevalence of defective MBL2 alleles between patients with chronic severe AR and HC. Sixteen percent of patients with chronic severe AR were homozygotes or compound heterozygotes for defective MBL alleles in contrast to 5% for HC (P = 0.0022; odds ratio, 3.5 [ 95% confidence interval, 1.6 to 7.7]). No association was detected with the variant of the MASP2 gene. Our study suggests that MBL deficiency may contribute to the development of chronic severe AR of rheumatic etiology.
Resumo:
Myb is a key transcription factor that can regulate proliferation, differentiation, and apoptosis, predominantly in the haemopoietic system. Abnormal expression of Myb is associated with a number of cancers, both haemopoietic and non-haemopoietic. In order to better understand the role of Myb in normal and tumorigenic processes, we undertook a cDNA array screen to identify genes that are regulated by this factor. In this way, we identified the gene encoding vascular endothelial growth factor (VEGF) as being potentially regulated by the Myb oncoprotein in myeloid cells. To determine whether this was a direct effect on VEGF gene transcription, we examined the activity of the murine VEGF promoter in the presence of either wild-type (WT) or mutant forms of Myb. It was found that WT Myb was able to activate the VEGF promoter and that a minimal promoter region of 120 bp was sufficient to confer Myb responsiveness. Surprisingly, activation of the VEGF promoter was independent of DNA binding by Myb. This was shown by the use of DNA binding-defective Myb mutants and by mutagenesis of a potential Myb-binding site in the minimal promoter. Mutation of Sp1 sites within this region abolished Myb-mediated regulation of a reporter construct, suggesting that Myb DNA binding-independent activation of VEGF expression occurs via these Sp1 binding elements. Regulation of VEGF production by Myb has implications for the potential role of Myb in myeloid leukaemias and in solid tumours where VEGF may be functioning as an autocrine growth factor. (c) 2006 Elsevier Inc. All rights reserved.
Resumo:
Hepatitis C virus (HCV) is a major cause of hepatic disease and of liver transplantation worldwide. Mannan-binding lectin (MBL), encoded by the MBL2 gene, can have an important role as an opsonin and complement activating molecule in HCV persistence and liver injury. We assessed the MBL2 polymorphism in 102 Euro-Brazilian patients with moderate and severe chronic hepatitis C, paired for gender and age with 102 HCV seronegative healthy individuals. Six common single nucleotide polymorphisms in the MBL2 gene, three in the promoter (H/L, X/Y and P/Q) and three in exon 1 (A, the wild-type, and B, C or D also known as O) were evaluated using real-time polymerase chain reaction with fluorescent hybridization probes. The concentration of MBL in plasma was measured by enzyme-linked immunosorbent assay. The frequency of the YA/YO genotype was significantly higher in the HCV patients compared with the controls (P = 0.022). On the other hand, the genotypes associated with low levels of MBL (XA/XA, XA/YO and YO/YO) were decreased significantly in the patients with severe fibrosis (stage F4), when compared with the patients with moderate fibrosis (stage F2) (P = 0.04) and to the control group (P = 0.011). Furthermore, MBL2 genotypes containing X or O mutations were found to be associated with non-responsiveness to pginterferon and ribavirin treatment (P = 0.023). MBL2 polymorphisms may therefore be associated not only with the development of chronic hepatitis C, but also with its clinical evolution and response to treatment.
Resumo:
Background Women with 21-hydroxylase deficiency present much variability in external genitalia virilization, even among those with similar impairments of 21-hydroxylase (21OH) activity. Objective To evaluate if the number of CAG (nCAG) repeats of the androgen receptor gene influences the degree of external genitalia virilization in women with CYP21A2 mutations, grouped according to impairment of 21OH activity. Patients The nCAG was determined in 106 congenital adrenal hyperplasia (CAH) patients and in 302 controls. The patients were divided, according to their CYP21A2 genotypes, into Groups A and B, which confer total and severe impairment of 21OH activity, respectively. Methods The inactivation pattern of the X-chromosome was studied through genomic DNA digestion with Hpa II. The CAG repeat region was amplified by polymerase chain reaction (PCR) and analysed by GeneScan. Results The nCAG and the frequency of severe skewed X-inactivation did not differ between normal women and patients. The nCAG median in genotype A was 20.7 (IQR 2.3) for Prader I + II, 22.5 (3.6) for Prader III and 21 (2.9) for Prader IV + V (P < 0.05 for Prader III and Prader IV + V). The nCAG median in genotype B was 21.3 (1.1) for Prader I + II, 20.5 (2.9) for Prader III and 22 (2.8) for Prader IV + V (P > 0.05). A significant difference was found regarding the nCAG median in patients presenting Prader III from genotypes A and B. Conclusions We observed great variability in the degree of external genitalia virilization in both CYP21A2 genotypes, and we showed that the CAG repeats of the androgen receptor gene influences this phenotypic variability.
Resumo:
Context: A better means to accurately identify malignant thyroid nodules and to distinguish them from benign tumors is needed. We previously identified markers for detecting thyroid malignancy, with sensitivity estimated at or close to 100%. One lingering problem with these markers was that false positives occurred with Hurthle cell adenomas (HCA) which lowered test specificity. Methods: To locate accurate diagnostic markers, we profiled in depth the transcripts of a HCA and a Hurthle cell carcinoma (HCC). From 1146 differentially expressed genes, 18 transcripts specifically expressed in HCA were tested by quantitative PCR in a wide range of thyroid tumors (n = 76). Sensibility and specificity were calculated using receiver operating characteristic (ROC). Selected markers were further validated in an independent set of thyroid tumors (n = 82) by immunohistochemistry. To define the panel that would yield best diagnostic accuracy, these markers were tested in combination with our previous identified markers. Results: Seventeen of the 18 genes showed statistical significance based on a mean relative level of expression (P < 0.05). KLK1 (sensitivity = 0.97) and PVALB (sensitivity = 0.94) were the best candidate markers. The combination of PVALB and C1orf24 increased specificity to > 97% and maintained sensitivity for detection of carcinoma. Conclusion: We identified tumor markers that can be used in combination for a more accurate preoperative diagnosis of thyroid nodules and for postoperative diagnosis of thyroid carcinoma in tumor sections. This improved test would help physicians rapidly focus treatment on true malignancies and avoid unnecessary treatment of benign tumors, simultaneously improving medical care and reducing costs. (J Clin Endocrinol Metab 96: E151-E160, 2011)
Resumo:
An efficient system is now in place for improving diverse sugarcane cultivars by genetic transformation, that is, the insertion of useful new genes into single cells followed by the regeneration of genetically modified (transgenic) plants. The method has already been used to introduce genes for resistance to several major diseases, insect pests and a herbicide, Field testing has begun, and research is underway to identify other genes for increased environmental stress resistance, agronomic efficiency and yield of sucrose or other valuable products. Experience in other crops has shown that genetically improved varieties which provide genuine environmental and consumer benefits are welcomed by producers and consumers. Substantial research is still needed, but these new gene technologies will reshape the sugar industry and determine the international competitive efficiency of producers.
Resumo:
The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.
Resumo:
The aim of this study was to investigate loss of heterozygosity (LOH) of the APC tumor suppressor gene loci, using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR) in 40 cases of oral squamous cell carcinoma (OSCC). Observed informativity was 72.5% for APC exon 11 and 82.5% for APC exon 15. LOH at APC exon 11 was observed in 2 (6.9%) of 29 informative cases, and no LOH was observed for APC exon 15. Our results suggest that inactivation of the APC gene plays a minor role in the carcinogenesis of OSCC. (C) 2008 Elsevier GmbH. All rights reserved.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Increased Kt concentration in seawater induces metamorphosis in the ascidian Herdmania momus. Larvae cultivated at 24 degrees C exhibit highest rates of metamorphosis when treated with 40 mM KCl-elevated seawater at 21 degrees C. At 24 degrees C, H. momus larvae develop competence to respond to KCl-seawater and initiate metamorphosis approximately 3 h after hatching. Larval trunks and tails separated from the anterior papillae region, but maintained in a common tunic at a distance of greater than 60 mu m, do not undergo metamorphosis when treated with KCl-seawater; normal muscle degradation does not occur in separated tails while ampullae develop from papillae-containing anterior fragments. Normal programmed degradation of myofibrils occurs when posterior fragments are fused to papillae-containing anterior fragments. These data indicate that H. momus settlement and metamorphosis only occurs when larvae have attained competence, and suggest that an anterior signalling centre is stimulated to release a factor that induces metamorphosis.
Resumo:
Purpose of review To perform an update review on thyroglobulin gene mutations associated with congenital hypothyroidism, thyroid cancer, and autoimmunity. Recent findings Forty-two thyroglobulin mutations have been identified in dyshormonogenetic congenital hypothyroidism. Clinical and laboratory criteria defining defective thyroglobulin synthesis are mostly related to thyroglobulin mutations, generally caused by intracellular thyroglobulin transport defects to the colloid rather than defects in thyroid hormones synthesis. Some mutated thyroglobulin may escape the rigorous chaperone control and reach the colloid, allowing a wide phenotypic spectrum that includes euthyroidism in an adequate iodine environment. In some patients, continuous levothyroxine treatment does not reduce elevated serum thyroid-stimulating hormone (TSH) levels that may lead to goiter development. Prenatally, inactive mutant thyroglobulin will not be able to synthesize thyroid hormones and may increase pituitary thyrotroph threshold for thyroid hormone feedback. Congenital goiter is a risk factor for thyroid cancer and some thyroglobulin variants may confer susceptibility to thyroid autoimmunity. Summary Advances in the understanding of thyroglobulin genetic defects and its severity should allow researchers to perform adequate molecular diagnosis, genetic counseling, and intrauterine treatment to prevent subtle deficits in central nervous system development. This knowledge should improve the understanding of physiological functions of the thyroid and influence of nutritional iodine.