978 resultados para Red-cell Folate


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to investigate loss of heterozygosity (LOH) of the APC tumor suppressor gene loci, using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR) in 40 cases of oral squamous cell carcinoma (OSCC). Observed informativity was 72.5% for APC exon 11 and 82.5% for APC exon 15. LOH at APC exon 11 was observed in 2 (6.9%) of 29 informative cases, and no LOH was observed for APC exon 15. Our results suggest that inactivation of the APC gene plays a minor role in the carcinogenesis of OSCC. (C) 2008 Elsevier GmbH. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The settling characteristics of cell debris and inclusion bodies prior to, and following, fractionation in a disc-stack centrifuge were measured using Cumulative Sedimentation Analysis (CSA) and Centrifugal Disc photosedimentation (CDS). The impact of centrifuge feedrate and repeated homogenisation on both cell debris and inclusion body collection efficiency was investigated. Increasing the normalised centrifuge feedrate (Q/Sigma) from 1.32 x 10(-9) m s(-1) to 3.97 x 10(-9) m s(-1) leads to a 36% increase in inclusion body paste purity. Purity may also be improved by repeated homogenisation. Increasing the number of homogeniser passes results in smaller cell debris size whilst leaves inclusion body size unaltered. At a normalised centrifuge feedrate of 2.65 x 10(-9) m s(-1), increasing the number of homogeniser passes from two (2) to ten (10) improved overall inclusion body paste purity by 58%. Grade-efficiency curves for both the cell debris and inclusion bodies have also been generated in this study. The data are described using an equation developed by Mannweiler (1989) with parameters of k = 0.15-0.26 and n = 2.5-2.6 for inclusion bodies, and k = 0.12-0.14 and n = 2.0-2.2 for cell debris. This is the first accurate experimentally-determined grade efficiency curve for cell debris. Previous studies have simply estimated debris grade efficiency curves using an approximate debris size distribution and grade efficiency curves determined with 'ideal particles' (e.g. spherical PVA particles). The findings of this study may be used to simulate and optimise the centrifugal fractionation of inclusion bodies from cell debris.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Adjuvant cisplatin-based chemoradiation improves survival in HNSCC patients presenting with risk features. ERCC1 (excision repair cross-complementation group 1) is associated with resistance to chemo- and radiation therapy and may have a prognostic value in HNSCC patients. Here we studied ERCC1 expression and the polymorphism T19007C as prognostic markers in these patients. This is a retrospective and translational analysis, where ERCC1 protein expression was evaluated by immunohistochemistry, using an H-score, and mRNA expression was determined by RT-PCR. T 19007C genotypes were detected by PCR-RFLP carried out using DNA template extracted from normal lymph nodes. A high H-score was seen in 32 patients (54%), who presented better 5-year overall survival (5-y OS: 50% vs. 18%, HR 0.43, p=0.026). Fifteen out of 45 patients (33%), with high mRNA expression, presented better 5-year overall survival (OS) (86% vs. 30%, HR 0.26, p=0.052). No OS difference was detected among T 19007C genotypes. High H-score and mRNA expression remained significant as favorable prognostic factors in a multivariate analysis. Collectively, our results suggest that high ERCC1 expression seems to be associated with better OS rates in HNSCC patients submitted to adjuvant cisplatin-based chemoradiation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aims: To analyse the expression of three homeobox genes (HOXA7, PITX1 and PRRX1) in oral squanous cell carcinomas (OSCC) and the relationship of such expression to certain distinct histopathological features of OSCC and in comparison to adjacent non-neoplastic epithelium (NT). Methods and results: Digoxigenin-labelled riboprobes that are specific for each homeobox gene were generated and in situ hybridization was carried out on frozen sections. In NT samples, HOXA7 and PITX1 transcripts were found more frequently in all epithelial layers, while PRRX1 was expressed in the basal layer. With OSCC samples, expression of the three genes was associated with all histological features. However, the HOXA7 and PITX1 signals were more intense in sheets and nests and PRRX1 in small nests and isolated cells. Conclusion: HOXA7, PIXT1 and PRRX1 homeobox genes have different patterns of expression in OSCC depending on its histological features.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context Perioperative red blood cell transfusion is commonly used to address anemia, an independent risk factor for morbidity and mortality after cardiac operations; however, evidence regarding optimal blood transfusion practice in patients undergoing cardiac surgery is lacking. Objective To define whether a restrictive perioperative red blood cell transfusion strategy is as safe as a liberal strategy in patients undergoing elective cardiac surgery. Design, Setting, and Patients The Transfusion Requirements After Cardiac Surgery (TRACS) study, a prospective, randomized, controlled clinical noninferiority trial conducted between February 2009 and February 2010 in an intensive care unit at a university hospital cardiac surgery referral center in Brazil. Consecutive adult patients (n=502) who underwent cardiac surgery with cardiopulmonary bypass were eligible; analysis was by intention-to-treat. Intervention Patients were randomly assigned to a liberal strategy of blood transfusion (to maintain a hematocrit >= 30%) or to a restrictive strategy (hematocrit >= 24%). Main Outcome Measure Composite end point of 30-day all-cause mortality and severe morbidity (cardiogenic shock, acute respiratory distress syndrome, or acute renal injury requiring dialysis or hemofiltration) occurring during the hospital stay. The noninferiority margin was predefined at -8% (ie, 8% minimal clinically important increase in occurrence of the composite end point). Results Hemoglobin concentrations were maintained at a mean of 10.5 g/dL(95% confidence interval [CI], 10.4-10.6) in the liberal-strategy group and 9.1 g/dL (95% CI, 9.09.2) in the restrictive-strategy group (P<.001). A total of 198 of 253 patients (78%) in the liberal-strategy group and 118 of 249 (47%) in the restrictive-strategy group received a blood transfusion (P<.001). Occurrence of the primary end point was similar between groups (10% liberal vs 11% restrictive; between-group difference, 1% [95% CI, -6% to 4%]; P=.85). Independent of transfusion strategy, the number of transfused red blood cell units was an independent risk factor for clinical complications or death at 30 days (hazard ratio for each additional unit transfused, 1.2 [95% CI, 1.1-1.4]; P=.002). Conclusion Among patients undergoing cardiac surgery, the use of a restrictive perioperative transfusion strategy compared with a more liberal strategy resulted in noninferior rates of the combined outcome of 30-day all-cause mortality and severe morbidity. Trial Registration clinicaltrials.gov Identifier: NCT01021631 JAMA. 2010; 304(14):1559-1567 www.jama.com

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Dendritic cells (DC) are potent APCs that enter resting tissues as precursors and, after Ag exposure, differentiate and migrate to draining lymph nodes. The phenotype of RelB knockout mice implicates this member of the NF kappa B/Rel family in DC differentiation. To further elucidate the role of RelB in DC differentiation, mRNA, intracellular protein expression, and DNA binding activity of RelB were examined in immature and differentiated human DC, as well as other PB mononuclear cell populations. RelB protein and mRNA were detected constitutively in lymphocytes and in activated monocytes, differentiated DC, and monocyte-derived DC. Immunohistochemical staining demonstrated RelB within the differentiated lymph node interdigitating DC and follicular DC, but not undifferentiated DC in normal skin. Active nuclear RelB was detected by supershift assay only in differentiated DC derived from either PB precursors or monocytes and in activated B cells. These RelB+ APC were potent stimulators of the MLR. The data indicate that RelB expression is regulated both transcriptionally and post-translationally in myeloid cells. Within the nucleus, RelB may specifically transactivate genes that are critical for APC function.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Sickle-cell disease is the most prevalent genetic disease in the Brazilian population. Lower limb ulcers are the most frequent cutaneous complications, affecting 8% to 10% of the patients. These ulcers are usually deep and may take many years to heal. Evidence about the effectiveness of systemic or topical treatment of these wounds is limited, apart from stabilization of the anemia. A 28-year old woman with sickle-cell disease was admitted for treatment of three deep chronic lower leg ulcers. All wounds had tendon exposure and contained firmly adherent fibrin slough. Following surgical debridement and before grafting, the wounds were managed with three different dressings: a rayon and normal saline solution dressing, a calcium alginate dressing covered with gauze, and negative pressure therapy. All three wounds healed successfully and their grafts showed complete integration; only the rayon-dressed wound required a second debridement. The alginate and rayon-dressed wounds recurred after 9 months and required additional skin grafts. Helpful research on managing ulcers in patients with sickle-cell disease is minimal, but the results of this case study suggest that topical treatment modalities may affect outcomes. Research to explore the safety and effectiveness of NPT in patients with sickle-cell wounds is warranted.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objectives: To evaluate p63 expression in laryngeal squamous cell carcinoma and its prognostic significance. Methods: p63 expression was examined by immunohistochemistry and scored in 127 patients with laryngeal squamous cell carcinomas. Results: Sixty-two cases had scored 3, sixty had scored 2, four had scored 1 and one case did not show any expression (48.8, 47.2, 3.1 and 0.8%, respectively). Overall survival was 73.9% at 24 months and 59.5% at 60 months. The disease-free survival was 77.2 and 75.1%, and the disease-specific survival was 79 and 67% at 24 and 60 months, respectively. Uni- and multivariate analysis identified that decreased immunoexpression of protein p63 was a statistically significant factor for the risk of recurrence and death by cancer. Conclusions: p63 expression was highly prevalent in laryngeal squamous cell carcinomas, and its underexpression was correlated with a worse prognosis. Copyright (C) 2010 S. Karger AG, Basel

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A distinct type of cellular organization was found in two species of the planctomycete genus Pirellula, Pirellula marina and Pirellula staleyi. Both species possess two distinct regions within the cell which are separated by a single membrane. The major region of the cell, the pirellulosome, contains the fibrillar condensed nucleoid. The other area, the polar cap region, forms a continuous layer surrounding the entire pirellulosome and displays a cap of asymmetrically distributed material at one cell pole. Immuno- and cytochemical-labelling of P. marina demonstrated that DNA is located exclusively within the pirellulosome; cell RNA is concentrated in the pirellulosome, with some RNA also located in the polar cap region.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The longest open reading frame of PKHD1 (polycystic kidney and hepatic disease 1), the autosomal recessive polycystic kidney disease (ARPKD) gene, encodes a single-pass, integral membrane protein named polyductin or fibrocystin. A fusion protein comprising its intracellular C-terminus, FP2, was previously used to raise a polyclonal antiserum shown to detect polyductin in several human tissues, including liver. In the current study, we aimed to investigate by immunohistochemistry the detailed polyductin localization pattern in normal (ductal plate [DP], remodelling ductal plate [RDP], remodelled bile ducts) and abnormal development of the primitive intrahepatic biliary system, known as ductal plate malformation (DPM). This work also included the characterization of polyductin expression profile in various histological forms of neonatal and infantile cholestasis, and in cholangiocellular carcinoma (CCC) and hepatocellular carcinoma (HCC). We detected polyductin expression in the intrahepatic biliary system during the DP and the RDP stages as well as in DPM. No specific staining was found at the stage of remodelled bile ducts. Polyductin was also detected in liver biopsies with neonatal cholestasis, including mainly biliary atresia and neonatal hepatitis with ductular reaction as well as congenital hepatic fibrosis. In addition, polyductin was present in CCC, whereas it was absent in HCC. Polyductin was also co-localized in some DP cells together with oval stem cell markers. These results represent the first systematic study of polyductin expression in human pathologies associated with abnormal development of intrahepatic biliary tree, and support the following conclusions: (i) polyductin expression mirrors developmental properties of the primitive intrahepatic biliary system; (ii) polyductin is re-expressed in pathological conditions associated with DPM and (iii) polyductin might be a potential marker to distinguish CCC from HCC.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A total of 53 patients aged 18-60 years with highintermediate or high-risk diffuse large B-cell lymphoma (DLBCL) were evaluated to analyze the impact of the cell of origin. Of 53 patients, 16 underwent autologous SCT (ASCT) in first remission and the rest received conventional chemotherapy. Immunohistochemistry was evaluated in 47 cases 17 were of germinal center (GC) origin and 30 were of non-GC origin. There was no survival difference between the two groups. Overall survival (OS) and disease-free survival (DFS) at 3 years were 93 and 83%, respectively, for the 14 patients who underwent ASCT. Their DFS was significantly better than that of patients who achieved CR but did not undergo ASCT. We conclude that ASCT is safe and improves the DFS of high-intermediate and high-risk DLBCL, regardless of the cell of origin. This observation should be confirmed in a larger study.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: p63 gene is a p53 homologue that encodes proteins with transactivation, DNA-binding and tetramerisation domains. The isoforms TAp63 and TAp73 transactivate p53 target genes and induce apoptosis, whereas the isoforms Delta Np63 and Delta Np73 lack transactivation and might have dominant-negative effects in p53 family members. p63 is expressed in germinal centre lymphocytes and can be related to the development of the lymphoma, but the prognostic significance of its expression in the survival of patients with diffuse large B-cell lymphoma (DLBCL) remains unclear. Aims: To determine whether quantitative immunohistochemical (IHC) analysis of p63 protein expression correlates with CD10 antigen, Bcl-6 antigen and IRF4 antigen expression and to determine whether p63 is a surrogate predictor of overall survival in high-intermediate and high risk DLBCL populations. Methods: CD10, Bcl-6 and IRF4 expression were retrospectively evaluated by IHC in 73 samples of high intermediate and high risk DLBCL and were used to divide the lymphomas into subgroups of germinal centre B-celllike (GCB) and activate B-cell-like (ABC) DLBCL. Similarly, p63 expression was evaluated by IHC and the results were compared with subgroups of DLBCL origin and with the survival rates for these patients. Results: p63 was expressed in more than 50% of malignant cells in 11 patients and did not show correlation with subgroups of GCB-like DLBCL or ABC-like DLBCL, but p63(+) patients had better disease-free survival (DFS) than those who were negative (p = 0.01). Conclusions: p63(+) high-intermediate and high risk DLBCL patients have a better DFS than negative cases.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We reviewed the data of 307 patients treated with autologous bone marrow transplantation with the aim to identify factors associated with poor hematopoietic stern cell (HSC) mobilization after administration of cyclophosphamide and granulocyte-colony stimulating factor. Success in mobilization was defined when >= 2.0 x 10(6) CD34+ cells/kg weight could be collected with <= 3 leukapheresis procedures. Success was observed in 260 patients (84.7%) and nonsuccess in 47 patients (15.3%). According to the stepwise regression model: diagnosis, chemotherapy load, treatment with mitoxantrone and platelet count before mobilization were found to be independent predictive factors for HSC mobilization. These results could help in the previous recognition of patients at risk for non response to mobilization and allow to plan an alternative protocol for this group of patients. (C) 2008 Elsevier Ltd. All rights reserved.