996 resultados para linhagens de cor


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Excessive and inadequate handling of fruits and vegetables provides high incidences of physical damage, consequently, post harvest losses. The main goal of this work was to evaluate the impact magnitude in persimmon packing lines, Rama Forte, and to determine, at the laboratory, its impact limits. For evaluating the critical points it was used an instrumented sphere of 76 mm of diameter (Technmark, Inc, Lansing, USA), which registered the impact magnitude in seven distinctive impact lines located in four packing houses. For determining physical damages, tests were carried out at the laboratory, where fruit drop was related to impact magnitude, physical damage incidence and fruit post harvest losses. At the packing lines, the values found varied from 21 to 87 G on the transfer points and the majority of registered impacts (over 94%) were down 50G. Drops from 20 cm caused an increase in weight losses after six days of storage at room temperature. Drops from 20 and 30 cm caused skin darkness (low L values), associated to a decrease in color intensity (chroma). Impact drop did not affect pulp fruit chemical features.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The presence of vegetal impurities in sugarcane delivered to sugarmills as green and dry leaves is a problem not only because they are non-value materials to be processed along with sugarcane stalks, but also because they can rise the color of the clarified juice and, consequently, the color of the sugar produced, with a reduction of its quality for the market. Another problem is the mud volume sedimented in the clarifiers, which also can result in a larger recirculation and greater volume of filtrate juice, with higher losses of sucrose and utilization of the vacuum rotary filters. The objective of this work was to observe the effect of the presence of green and dry leaves on sugarcane juice clarification, related to a control treatment with the addition of fiber extracted from the stalks. The experiments were planned based on the addition of quantities of fibrous sources in order to formulate samples with absolute increase of 0.25 , 0.50 and 0.75 percentual points over the fiber content of the sugarcane stalks (control treatment). The juice clarification was conducted with a laboratory clarifier. The clarified juice color and the mud volume were evaluated. The presence of green leaves caused higher color and mud volume due to the extraction of non-sucrose components of the leaves. Soluble compounds of dry leaves were also extracted, though not detected by juice analysis. The addition of the fiber extracted from the stalks did not induce alterations in the clarification process.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Aflatoxins are hepatotoxic metabolites produced by Aspergillus flavus and A. parasiticus on a number of agricultural commodities. This research was carried out to evaluate the ability of thermolysed and active Saccharomyces cerevisiae to attenuate liver damage caused by aflatoxin. Diets were prepared containing 0 aflatoxin; 400 mug kg-1 aflatoxin; 400 mug kg-1 aflatoxin plus 1% of dehydrated active yeast, and 400 mug kg-1 aflatoxin plus 1% of thermolysed yeast. A bioassay with Wistar rats was conducted for 28 days, and body organs were weighted and analyses of the liver tissue of the animals were performed. The relative weight of heart, kidneys and liver from animals submitted to the different treatments did not show any difference, and liver tissue of animals feeding on the aflatoxin-free diet was adopted as a toxicity-free pattern. Hepatic tissue of animals feeding on diets containing 400 mug kg-1 aflatoxin or the diet supplemented with 1% thermolysed yeast showed clear signs of toxicity and damage. Hepatic tissue of animals feeding on the diet containing 1% of dehydrated active yeast showed less toxicity signs and damage than those receiving the diet containing 400 mug kg-1 aflatoxin. Active, dehydrated yeast had the ability to reduce toxic effects caused by aflatoxin, but thermolysed yeast was not able to alleviate the effects of aflatoxin toxicity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The durability and postharvest quality of cut flowers are fundamental attributes in value along the production chain and in consumer satisfaction. The objective of this study was to evaluate the effect of chemical inhibitors of ethylene action on maintaining the postharvest quality of chrysanthemum stems (Chrysanthemum morifolium Ramat cv. Dragon). The experiment tested maintenance solutions with silver thiosulfate (STS) under five levels (distilled water, a 0.2 mM STS, the STS 0.2 mM + sucrose at 50 g L-1, STS at 0.4 mM; STS at 0.4 mM + sucrose at 50 g L-1), and date of sampling, for three levels (0, 3, 6 days). Three replications with two flower stems in each treatment were used in the experiment. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, flower color, and number of buds, open flowers and partially open flowers. Treatment with 0.2 mM STS resulted in better maintenance of fresh mass of stems. The concentration of pigments and reducing sugar was higher in those treatments in which sucrose was associated. The color and relative water content were favored in treatments STS 0.2 mM and 0.4 mM. The concentration of 0.2 mM STS obtained the best results, prolonging the vase life the stems. The quality of these stems was higher, with the best assessments of water content, color and turgidity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The development and use of techniques that extend the life vase of the flowers, maintaining the quality of the product, is essential for reducing postharvest losses. The objective of this work was to evaluate different solutions for maintenance, associated or not to sucrose, in maintaining the postharvest quality of chrysanthemum stems. The treatments used distilled water, 8-HQC to 100 mg L-1, 8-HQC to 100 mg L-1 + sucrose 50 g L-1, 8-HQC to 200 mg L-1, 8-HQC to 200 mg L-1 + sucrose 50 g L-1. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, color of the flowers, and number of buttons, open flowers and partially open flowers. The combination of 8-HQC 200 mg L-1 + sucrose 50 g L-1 was the best performance that made for maintaining the quality of flower stems, favoring the opening of buttons and turgidity of petals. Sucrose contributed to better maintenance of the reserve substances in the shaft, which had increased the flower vase life.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Quality traits of boneless rib cut (L. dorsi muscle) from Nelore young bulls. To study the meat quality traits of Nelore breed young bulls, and the effect of age (690-780 days) on them, 113 animals were slaughtered after 109 days of intensive feeding with 20% concentrate and 80% roughage. All the carcasses were graded at the slaughter floor by the Federal Inspection and chilled for 24 hours (Tinitial=5°C, Tfinal=2°C). Fifty one half carcasses (right side), type B - B R A S I L `s grading system - from animals of 23 to 26 months were boned and separated into commercial cuts. Two steaks (2.5cm thick) were removed from each boneless rib cut (m. L. dorsi), vacuum packaged and aged for 7 days (0-2°C). The pH varied from 5.44 to 5.83 and only two samples had pH ³ 5.70. The L* (brightness) average value was 34.85. The water and fat content were 75.65% and 1.71%, respectively. The average WB shear force was 6.70kg, and it was not affected by age (690-734 days), but presented a trend (t test, p=0.22) for increasing values between 735 and 780 days. Animal age did not affect other quality traits (t test, p>0.20). It was concluded that the rib cut from Nelore young bulls may not have a good acceptability in exigent markets, and that carcasses graded B, presumed to be the best grade, do not necessarily present the best meat quality characteristics.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Twenty-two Triceps brachii muscle obtained from 11 cows aged 3 and 4 years , killed in an experimental slaughter plant, were submitted to mechanical tenderization, injection with acetic acid 0,1M and lactic acid 0,2M, ageing for 9 and 14 days and electrical stimulation (250v - 60Hz - 90s), some of them were reserved as a control group, without treatment. The 14 days ageing time presented 21% of increase in subjective tenderness and 12% of reduction in shear force, these values were similar to the electrical stimulated meat. However the injection with acids and the ageing time 9 days did not present significant effect in the texture. Although the shear force values of mechanical tenderized meat was the shortest among all treatments, suspect of superestimation because of the fractures plan created by this process. Another analyses were carried out: pH reduction curve, R value; colour analysis; weight losses by cooking and by treatment; and microbiological analysis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Shelled, roasted and salted cashew nut kernels were packaged in three different flexible materials (PP/PE= polypropylene / polyethylene; PETmet/PE= metallized polyethylene terephthalate / polyethylene; PET/Al/LDPE= polyethylene terephthalate / aluminum foil / low density polyethylene ), with different barrier properties. Kernels were stored for one year at 30° C and 80% relative humidity. Quantitative descriptive sensory analysis (QDA) were performed at the end of storage time. Descriptive terms obtained for kernels characterization were brown color, color uniformity and rugosity for appearance; toasted kernel, sweet, old and rancidity for odor; toasted kernel, sweet, old rancidity, salt and bitter for taste, crispness for texture. QDA showed that factors responsible for sensory quality decrease, after one year storage, were increase in old aroma and taste, increase in rancidity aroma and taste, decrease in roasted kernel aroma and taste, and decrease of crispness. Sensory quality decrease was higher in kernels packaged in PP/PE.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This work aimed at determining the occurrence of heat resistant molds during the aseptic processing of tomato pulp (8° BRIX). During tomato harvest, 9 lots were sampled (3 at the beginning, 3 at the apex and 3 at the end of harvest) and other 5 lots were sampled between harvest. For each lot, the enumeration of heat resistant molds was carried out in samples collected during the aseptic process. The mean count of heat resistant molds was relatively low, ranging from <1 to 8CFU/100mL of sample. The higher counts were observed in the raw material and the pre-wash and transportation water. Fifty strains of heat resistant molds detected in the enumeration procedure were isolated, codified and stocked. One-month-old spores of each isolate were submitted to different heat shocks to select the most heat resistant mold. The most heat resistant isolated strain (survived 100° C/25 minutes) was identified as Neosartorya fischeri.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Easter egg is a popular chocolate-candy in egg form commercialized in Brazil during Easter time. In this research, Quantitative Descriptive Analysis was applied to select sensory attributes which best define the modifications in appearance, aroma, flavor and texture when cocoa butter equivalent (CBE) is added to Easter eggs. Samples with and without CBE were evaluated by a selected panel and fourteen attributes best describing similarities and differences between them, were defined. Terms definition, reference materials and a consensus ballot were developed. After a training period, panelists evaluated the samples in a Complete Block Design using a 9 cm unstructured scale. Principal Component Analysis, ANOVA and Tukey test (p<0.05) were applied to the data in order to select attributes which best discriminated and characterized the samples. Samples showed significant differences (p<0.05) in all attributes. Easter egg without CBE showed higher intensities (p<0.05) in relation to the following descriptors: brown color, characteristic aroma, cocoa mass aroma, cocoa butter aroma, characteristic flavor, cocoa mass flavor, hardness and brittleness.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A 6 month-old mulatto boy was admitted on account of acute gastroenteritis, malnutrition and dehydration. In the hospital, the child developed septicemia, and temperature reached up to 38.6°C. Despite intensive antibiotic treatment, the patient died 12 days after admission. Necropsy disclosed bilateral bronchopneumonia, bilateral fronto-parietal subarachnoid hemorrhage, and extensive necrosis of the inferior half of both cerebellar hemispheres. On histopathological examination of the necrotic cerebellar cortex, numerous sickled erythrocytes were observed in petechial hemorrhages and, in lesser quantities, inside capillaries. Lesions of the central nervous system in sickle cell anemia most often involve the cerebral cortex, and a single extensive cerebellar infarction as present in this case seems extremely rare. The pathogenetic mechanism of the necrosis is unclear, since thrombosis was not observed either in large blood vessels or in capillaries. Possible contributory factors were the infectious condition (septicemia), fever, and anoxia caused by the extensive bronchopneumonia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A case of brain abscess and meningitis due to pigmented fungi is reported. The patient was a 59-year-old white male, who had enjoyed excellent health until October 1977, when he developed headache, later accompanied by paresthesias and weakness in the left-sided extremities. These symptoms worsened progressively and in November of that year he had to quit his job. From February 1978 on he became inactive and anorexic. Intense continuous headache was associated with frequent episodes of vomiting. He gradually became tor-porous, and according to his relatives, suffered from visual and possibly auditory deficiency. On examination, he was malnourished and dehydrated, with decubitus ulcers. Temperature was 38,5°C. A left-sided spastic hemiplegia and prominent meningorradicular signs were noted. The CSF was examined six times between May 17th and June 1st and showed variable hypercytosis (143 to 4,437 leucocytes/ cu mm) with predominance of neutrophils (up tp 95%), low glucose and high protein concentrations. No microorganisms were identified. Electroencephalographic study disclosed a low background activity especially in left temporal areas. Despite supportive care and antibiotic therapy he lapsed into coma. Carotid angiography was normal on June 1st. He remained in deep coma until his death on June 6th, 1978. Necropsy was limited to the brain, which weighed 1,550 g after fixation and showed diffuse intense edema and hyperemia. On coronal sectioning an encapsulated abscess was found in the right basal ganglia, which also involved the internal capsule, and measured 1.5 cm in diameter. Microscopical examination disclosed large numbers of brownish fungi, appearing both as oval yeasts and as septate hyphae in the thick fibrous capsule and in the necrotic content of the abscess. The same organisms were demonstrated in moderate numbers in the leptomeninges of the medulla oblongata and , less frequently, of the hippo-campal region and cerebellum.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física