965 resultados para Phase-Control
Resumo:
The aim of this study was to analyze the prevalence of hypertension and control practices among the elderly. The survey analyzed data from 872 elderly people in São Paulo, Brazil, through a cluster sampling, stratified according to education and income. A Poisson multiple regression model checked for the existence of factors associated with hypertension. The prevalence of self-reported hypertension among the elderly was 46.9%. Variables associated with hypertension were self-rated health, alcohol consumption, gender, and hospitalization in the last year, regardless of age. The three most common measures taken to control hypertension, but only rarely, are oral medication, routine salt-free diet and physical activity. Lifestyle and socioeconomic status did not affect the practice of control, but knowledge about the importance of physical activity was higher among those older people with higher education and greater income. The research suggests that health policies that focus on primary care to encourage lifestyle changes among the elderly are necessary.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
This study analyzed the association of periodontal disease (PD) and rheumatoid arthritis (RA). Seventy-five 35-60-year-old patients were assigned to 5 groups according to the presence (+) or not (-) of PD and RA and the treatment received (TR+) or not (TR-) for PD. Group 3 uses total prosthesis (TP). Clinical and laboratory evaluations were performed at baseline, 3 and 6 months of follow-up by probing pocket depth, bleeding on probing and plaque index for PD, HAQ, DAS28, SF-36 and laboratory: AAG, ESR, CRP for RA. Statistically significant differences for PD after 3 (p=0.0055) and after 6 months (p=0.0066) were obtained in Group 1 (RA+PD+TR+) and 2(RA+PD+TR-); significant reduction in the % of BOP after 6 months (p=0.0128) and significant reduction in the % of Pl after 3 (p=0.0128) and 6 months (p=0.0002) in Group 1. Statistically significant differences between Groups 1 and 3 (RA+TP) for DAS28 at baseline and after 3 months were observed, but not after 6 months. No other parameters for RA were significantly affected. The relationship between RA and PD disease activities is not clear, but the importance of periodontal treatment in the control of inflammation to avoid tooth extraction is evident.
Resumo:
Dental erosion is a type of wear caused by non bacterial acids or chelation. There is evidence of a significant increase in the prevalence of dental wear in the deciduous and permanent teeth as a consequence of the frequent intake of acidic foods and drinks, or due to gastric acid which may reach the oral cavity following reflux or vomiting episodes. The presence of acids is a prerequisite for dental erosion, but the erosive wear is complex and depends on the interaction of biological, chemical and behavioral factors. Even though erosion may be defined or described as an isolated process, in clinical situations other wear phenomena are expected to occur concomitantly, such as abrasive wear (which occurs, e.g, due to tooth brushing or mastication). In order to control dental loss due to erosive wear it is crucial to take into account its multifactorial nature, which predisposes some individuals to the condition.
Resumo:
The mechanical control of supragingival biofilm is accepted as one of the most important measures to treat and prevent dental caries and periodontal diseases. Nevertheless, maintaining dental surfaces biofilm-free is not an easy task. In this regard, chemical agents, mainly in the form of mouthwashes, have been studied to help overcome the difficulties involved in the mechanical control of biofilm. The aim of this paper was to discuss proposals for the teaching of supragingival chemical control (SCC) in order to improve dentists' knowledge regarding this clinical issue. Firstly, the literature regarding the efficacy of antiseptics is presented, clearly showing that chemical agents are clinically effective in the reduction of biofilm and gingival inflammation when used as adjuvant agents to mechanical control. Thus, it is suggested that the content related to SCC be included in the curricular grid of dental schools. Secondly, some essential topics are recommended to be included in the teaching of SCC as follows: skills and competencies expected of a graduate dentist regarding SCC; how to include this content in the curricular grid; teaching-learning tools and techniques to be employed; and program content.