999 resultados para resistência do solo a penetração
Resumo:
Sugarcane holds an important place in the Brazilian economy. Grate part of the sugarcane harvested still accomplished largely manually. Sugarcane harvesters available in Brazil use the technology to chop the cane into 200 to 300 mm billets to allow on the go cane transferring to transport, contradicting the traditional method of whole stalk sugarcane harvesting system. In order to make whole stalk mechanical harvesting system possible, one of the barriers to be expired is the mechanical removal of the straw. The design of a mechanism that accomplishes this operation depends directly on the knowledge of the mechanical properties of the sugarcane related to its resistance to compression and the forces necessary to remove the leaves from the stalk. Compression tests were conducted using the universal testing machine. For leaves removal test by friction, a special apparatus was designed to allow the registration of the normal and traction force. The sugarcane stalk can resist up to 4.9 MPa. With a normal pressure of 0.8 MPa, which correspond to a friction force of 315 N, it is possible to remove the leaves, independent of its location in the sugarcane stalk.
Resumo:
An alternative proposal for floor heating system by means of electric resistance for both chick and piggy installation is presented in this work. Several formulations of rice husk and cement mortar boards were used. An electronic device controlled all board temperature. This system presented a good efficiency design. The conventional cement mortar mixed with rice husk showed a better performance.
Resumo:
The physical model was based on the method of Newton-Euler. The model was developed by using the scientific computer program Mathematica®. Several simulations where tried varying the progress speeds (0.69; 1.12; 1.48; 1.82 and 2.12 m s-1); soil profiles (sinoidal, ascending and descending ramp) and height of the profile (0.025 and 0.05 m) to obtain the normal force of soil reaction. After the initial simulations, the mechanism was optimized using the scientific computer program Matlab® having as criterion (function-objective) the minimization of the normal force of reaction of the profile (FN). The project variables were the lengths of the bars (L1y, L2, l3 and L4), height of the operation (L7), the initial length of the spring (Lmo) and the elastic constant of the spring (k t). The lack of robustness of the mechanism in relation to the variable height of the operation was outlined by using a spring with low rigidity and large length. The results demonstrated that the mechanism optimized showed better flotation performance in relation to the initial mechanism.
Resumo:
The aim of this research was to study the effect of chemical additives (lime and Portland cement) associated with sodium silicate on soil in order to obtain compressed soil bricks. Mini panels were constructed with such bricks being their physical and mechanical characteristics determined in laboratory conditions and their behavior evaluated through the association of destructive and non-destructive methods. For this purpose a sandy soil and a finely divided one were added to Portland cement and lime in the dosage of 6% and 10% taken in dry weight basis in relation to the dry soil. The sodium silicate dosage of 4% was also taken in dry weight basis in relation to the dry soil-cement or to the dry soil-lime. The compressed soil bricks were cured in a humidity chamber for 7; 28; 56 and 91 days. The bricks were laid on the fourteenth day to form prismatic mini panels each one with four layers of bricks. After 28; 56 and 91 days the mini panels were submitted to both; ultrasonic and compressive tests to determine its elastic properties (dynamic modulus) and the compressive resistance. The best results in terms of compressive strength, water absorption capacity or dynamic elastic modulus, were reached by the sandy soil added to 10% of Portland cement or lime associated with sodium silicate.
Resumo:
The covering of the soil is an agricultural practice that intends to control the harmful herbs, to reduce the losses of water by evaporation of the soil, and to facilitate the harvest and the commercialization, once the product is cleaner and healthier. However, when the soil is covered important microclimatic parameters are also altered, and consequently the germination of seeds, the growth of roots, the absorption of water and nutrients, the metabolic activity of the plants and the carbohydrates storage. The current trial intended to evaluate the effect of soil covering with blue colored film on consumptive water-use in a lettuce crop (Lactuca sativa, L.). The experiment was carried out in a plastic greenhouse in Araras - São Paulo State, Brazil from March 3rd, 2001 to May 5th, 2001. The consumptive water-use was measured through two weighing lysimeter installed inside the greenhouse. Crop spacing was 0.25 m x 0.25 m and the color of the film above soil was blue. Leaf area index (IAF), was measured six times (7; 14; 21; 28; 35; 40 days after transplant) and the water-use efficiency (EU) was measured at the end. The experimental design was subdivided portions with two treatments, bare soil and covered soil. The average consumptive water-use was 4.17 mm day-1 to the bare soil treatment and 3.11 mm day-1 to the covered soil treatment. The final leaf area index was 25.23 to the bare soil treatment and 24.39 to the covered soil treatment, and there was no statistical difference between then.
Resumo:
The main objective of this work is the study of the effect of rice husk addition on the physical and mechanical properties of soil-cement, in order to obtain an alternative construction material. The rice husk preparation consisted of grinding, sieving, and the pre-treatment with lime solution. The physical characteristics of the soil and of the rice husk were determined. Different amounts of soil, cement and rice husk were tested by compaction and unconfined compression. The specimens molded according to the treatments applied to the mixtures were subsequently submitted to compression testing and to tensile splitting cylinder testing at 7 and 28 days of age and to water absorption testing. After determining its physical and mechanical characteristics, the best results were obtained for the soil + 12% (cement + rice husk) mixture. The results showed a promising use as an alternative construction material.
Resumo:
Time Domain Reflectometry (TDR) is a reliable method for in-situ measurements of the humidity and the solution concentration at the same soil volume. Accurate interpretation of electrical conductivity (and soil humidity) measurements may require a specific calibration curve. The primary goal of this work was to establish a calibration procedure for using TDR to estimate potassium nitrate concentrations (KNO3) in soil solution. An equation relating the electrical conductivity measured by TDR and KNO3 concentration was established enabling the use of TDR technique to estimate soil water content and nitrate concentration for efficient fertigation management.
Resumo:
The objective of this study was to quantify the effect of plonk on compressive behavior and mechanical attributes such as consistency, optimum moisture for compaction and maximum density of a Red-Yellow Latosol (Oxisol) to evaluate the effect of plonk and compaction state in splashed particles, from Lavras (MG) region. The plonk was obtained from an artisanal sugarcane brandy alembic. Undisturbed and disturbed soil samples were collected at 0 to 3 cm and 60 to 63 cm depths. Disturbed soil samples were used for soil characterization, determination of consistence limits and Normal Proctor essay after material incubation with plonk. Undisturbed soil samples were saturated with plonk or distilled water (control) during 48 hours for testing the compressibility and resistance to splash by using simulated rainfall. The plonk altered the consistence limits of studied layers. For the 0-3 cm layer, the plonk reduced the friable range, and for the 60-63 cm layer the effect was in the opposite direction. For both layers, the plonk increased Dmax and decreased Uoptimum. Regardless of the plonk treatment, both layers presented the same load support capacity. The compaction degree of samples influenced the splash erosion. The increase of the applied pressure over the samples resulted in increase of splash material quantity. At the 60-63 cm layer, the plonk treatment reduced the splash material quantity by increasing the applied pressure, mainly when the samples were at field capacity.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUÇÃO: apesar da colagem direta despender menor tempo clínico, com maior preservação da integridade gengival, ainda hoje se observa uma alta incidência de bandagem dos molares. Portanto, torna-se interessante a idealização de recursos para o aumento da eficiência desse procedimento para dentes submetidos a maiores impactos mastigatórios, como, por exemplo, os molares. OBJETIVO: esse estudo teve o propósito de avaliar se a resistência à adesão com a aplicação de uma camada de resina adicional na região oclusal da interface tubo/dente aumenta a qualidade do procedimento de colagem direta de tubos em molares. MÉTODOS: selecionou-se uma amostra composta por 40 terceiros molares inferiores, que foram aleatoriamente divididos em 2 grupos: Grupo 1 - colagem direta convencional, seguida pela aplicação de uma camada de resina na oclusal da interface tubo/dente; e Grupo 2 - colagem direta convencional. O teste de resistência ao cisalhamento foi realizado 24 horas após a colagem, utilizando-se uma máquina de ensaio universal, operando a uma velocidade de 0,5mm/min. Os resultados foram analisados por meio do teste t independente. RESULTADOS: os valores médios obtidos nos testes de cisalhamento foram: 17,08MPa para o Grupo 1 e 12,60MPa para o Grupo 2. O Grupo 1 apresentou uma resistência ao cisalhamento estatisticamente significativa mais alta do que o Grupo 2. CONCLUSÃO: a aplicação de uma camada adicional de resina na oclusal da interface tubo/dente aumenta a qualidade da adesão do procedimento de colagem direta de tubos ortodônticos em molares.
Resumo:
OBJETIVO: o propósito do presente estudo é avaliar o limite de resistência à flexão de um protótipo de mini-implante desenvolvido para ancoragem do aparelho de Herbst. MÉTODOS: após a realização de um cálculo do tamanho da amostra, quatro corpos de prova contendo os protótipos de mini-implantes foram submetidos a uma força de flexão por engastamento simples, utilizando-se uma máquina universal de ensaios mecânicos, sendo calculado o limite de resistência à força de flexão. RESULTADOS: após os ensaios mecânicos, os novos mini-implantes apresentaram o limite de resistência à força de flexão de 98,2kgf, que foi o menor valor encontrado. CONCLUSÃO: os protótipos de mini-implantes desenvolvidos para ancoragem do aparelho de Herbst foram capazes de suportar forças de flexão maiores do que as forças de mordida descritas na literatura.
Resumo:
A redução da disponibilidade de espécies de madeiras nativas e seus efeitos na economia, associada ao fortalecimento dos conceitos de preservação ambiental, criou a necessidade de desenvolvimento de alternativas viáveis para utilização racional de espécies de reflorestamento. E uma das opções é a realização de classificação visual das peças. Autores de trabalhos desenvolvidos nessa linha de pesquisa verificaram a adequação das regras de classificação visual do Southern Pine Inspection Bureau (SPIB) dos EUA à madeira de Pinus do Brasil e apresentaram proposta para normalizar o processo de classificação visual dessa madeira. Nessa classificação, os aspectos com maior influência são: presença de nós, desvio de grã em relação ao eixo da peça e densidade de anéis de crescimento. Assim, esta pesquisa apresenta um estudo experimental que consistiu na classificação visual e determinação da resistência à tração de 85 peças de Pinus spp e um estudo teórico, que propôs uma equação para determinar a resistência à tração média de peças estruturais em função da classificação visual. Com este trabalho, foi possível observar a influência dos nós e dos anéis de crescimento sobre a resistência à tração das peças analisadas.
Resumo:
A escória siderúrgica é uma alternativa para a correção da acidez dos solos e é constituída de silicato de cálcio. Neste estudo, avaliaram-se os efeitos residuais da aplicação de silicato de cálcio nos atributos químicos do solo e da planta em Latossolo Vermelho distroférrico típico com capim-Marandu (Brachiaria brizantha cv. Marandu), sob intensidades de pastejo em lotação rotacionada. O delineamento experimental foi de blocos ao acaso, com intensidades de pastejo avaliadas pelas ofertas diárias de forragem de 50, 100, 150 e 200 kg t-1 de MS por PV nas parcelas experimentais, enquanto a aplicação superficial de silicato de cálcio combinado com calcário dolomítico, respectivamente, nas doses 0 + 0; 2 + 0; 4 + 0; 6 + 0; 2 + 4; 4 + 2 e 0 + 6 t ha- 1 nas subparcelas com quatro repetições, duas épocas (verão e inverno) e avaliação em três profundidades do solo (0-10, 10-20 e 20-40 cm). Os atributos químicos do solo pH em CaCl2, Ca, Mg, K, H + Al e V, avaliados 720 dias após a aplicação, apresentaram resultados favoráveis do poder residual do silicato de Ca e do calcário. A oferta de forragem 200 kg t-1 e o tratamento somente com calcário dolomítico (0 + 6 t ha-1) elevaram o valor de pH em CaCl2 e o V, principalmente na camada de 0-10 cm. Os teores de Si no solo foram influenciados pelas doses aplicadas de silicato de Ca, apesar de não terem causado alterações significativas nos teores foliares de Si. A composição químico-bromatológica foi afetada somente pelas ofertas e épocas. As ofertas, épocas e a interação época x oferta resultaram em efeitos na produção de matéria seca no pré-pastejo, com maiores produções para a oferta 200 kg t-1 e menores para a de 50 kg t-1 nas duas épocas. O resíduo (pós-pastejo) foi influenciado pelas ofertas e épocas. As ofertas 50 e 100 kg t-1 e o tratamento com 2 t ha-1 de silicato de Ca promoveram as maiores taxas de acúmulo de matéria seca.
Resumo:
The vinasse, awaste produced in the proportion of 13 liters for each liter of alcohol. It has a high potential of polluting groundwater and superficial water resources, changes the soil behaviour and can also develop sanilization problems. This work aims to evaluate the efficiency of the DC-resistivity method in detecting and mapping anomalies caused by inappropriate disposal of vinasse in an inactive infiltration tank located at Sepé-Tiarajú settlement of landless agricultural laborers in the Ribeirão Preto region. Besides, as secondary goals, this work aims to characterize the type of anomaly residue as well as to diagnose its influence inside and outside of the limits of the tank. Eleven electrical resistivity tomography profiles were carried out with the dipole-dipole array, 10m of dipoles length and 5 leveis of investigation The geophysical survey enabled us to conclude that the DC-resistivity method is appropriate for mapping the contamination plume caused by intense vinasse disposal and its influence. It enabled also to conclude that the contamination exceeds the tank limits. The vinasse influence can be characterized by low resistivity values between 10 Ohm.m and 90 Ohm.m and its behavior can be compared with the one of the chorume, which is also conductive.
Resumo:
Neste artigo visamos apontar, apoiadas em W. Benjamim e G. Agamben, a fragilização do registro da experiência e sua incidência na lógica do poder/violência. Analisamos, pretendendo desmistificar a eficácia dos discursos mortificadores da experiência, a figura do "mulçumano"; - nome que designava os mortos-vivos nos campos de concentração, conforme relato de Primo Levi e outros. Tal figura é emblemática do estado limite a que chegaram algumas pessoas e podem expressar o destino de alguns sujeitos na contemporaneidade. Pudemos identificar nessa posição tanto um movimento na direção da perda do laço identificatório com o semelhante, como uma forma de resistência à violência perpetrada pelo discurso social. Tal resistência consiste em operar uma mimese ao objeto resto, o que permite ao sujeito a manutenção da estrutura fantasmática. Indicamos que, apesar das estratégias do poder, o sujeito reinventa modos de se situar na relação ao Outro, nos quais se fazem importantes a presença e a palavra, incluindo aí a experiência psicanalítica.