Sliding wear of weld layers with application to cane mill shaft rebuilding

Three welding procedures used to rebuild worn shafts in sugar cane mills were analysed: two submerged arc welding processes and one flux cored arc welding (FCAW) process. Sliding wear tests were in accordance with ASTM G 77 standard, using rings of welding material, blocks of bronze SAE 67, and oil as lubricant. The worn surfaces of rings and blocks were analysed by scanning electron microscopy to determine the wear mechanisms. High contact pressure, high operating temperature, and low relative speed were applied in sliding wear tests to match the conditions in sugar cane mills. Transferred material and evidence of adhesive junctions were detected. Additionally, hardened fragments produced abrasive grooves on the worn surfaces. The welding deposits that presented strong adhesion on the worn surface showed higher mass loss than the materials that presented more abrasive characteristics. Plastic mechanical properties were measured and related to the mass loss. The tested materials presented similar hardness but different yield stress and hardening coefficient. A relationship between wear, strain hardening coefficient, and yield stress was found. The welding deposit that presented the highest hardening coefficient showed the highest mass loss, with evidence of severe adhesion on the worn surface.

Phenolic matrices and sisal fibers modified with hydroxy terminated polybutadiene rubber: Impact strength, water absorption, and morphological aspects of thermosets and composites

The aim of the present work was to investigate the toughening of phenolic thermoset and its composites reinforced with sisal fibers, using hydroxyl-terminated polybutadiene rubber (HTPB) as both impact modifier and coupling agent. Substantial increase in the impact strength of the thermoset was achieved by the addition 10% of HTPB. Scanning electron microscopy (SEM) images of the material with 15% HTPB content revealed the formation of some rubber aggregates that reduced the efficiency of the toughening mechanism. In composites, the toughening effect was observed only when 2.5% of HTPB was added. The rubber aggregates were found located mainly at the matrix-fiber interface suggesting that HTPB could be used as coupling agent between the sisal fibers and the phenolic matrix. A composite reinforced with sisal fibers pre-impregnated with HTPB was then prepared; its SEM images showed the formation of a thin coating of HTPB on the surface of the fibers. The ability of HTBP as coupling agent between sisal fibers and phenolic matrix was then investigated by preparing a composite reinforced with sisal fibers pre-treated with HTPB. As revealed by its SEM images, the HTPB pre-treatment of the fibers resulted on the formation of a thin coating of HTPB on the surface of the fibers, which provided better compatibility between the fibers and the matrix at their interface, resulting in a material with low water absorption capacity and no loss of impact strength. (C) 2009 Elsevier B.V. All rights reserved.

Molecular mass distribution of dextran in Brazilian sugar and insoluble deposits of cachaca

The dextran molecular mass distribution profile in 77 sugar samples from Brazil and twelve insoluble deposits (alcoholic flocks) samples from sugared cachacas (Brazilian sugar cane spirit) is described in terms of number-average molecular mass M,,, weight-average molecular mass M(w), Z-average molecular mass M,, and polydispersity. The analyses were performed by size-exclusion chromatography, using a refractive index detector. In most of the sugar samples, it was possible to identify two major groups of dextrans with Mw averages of 5 x 10(6) and 5 x 10(4) Da. Based on the evaluated parameters, the dextran distribution profile is about the same in samples analyzed over five seasons, and, therefore, it is likely that the Brazilian product pattern will not change very much over the years. In insoluble deposits from sugared cachacas, dextrans with Mw values in the order of the 10(5) Da were the most frequent ones, being present in 58% of the samples. (c) 2008 Elsevier Ltd. All rights reserved.

Analysis of the performance of an extraction-condensation steam turbine on a cogeneration system of a Brazilian sugar-alcohol factory

In this work a detailed thermodynamic analysis for an extraction-condensation steam turbine capable to drive a 40 MVA electricity generator in a sugar-alcohol factory was carried out. The use of this turbine in the cogeneration system showed that its efficiency contributed to increase the power generation, although the condensation reduces the overall efficiency of the plant. Sensibility analyses were performed to evaluate the behavior of the overall energy efficiency of a plant with the extraction-condensation turbine in function of the boiler efficiency, the specific consumption of steam in the processes and the condensation rate in the turbine. It was observed that the plant efficiency is very sensible to the condensation rate variation and it increases when there is an increase in the demand of steam for processes.

Polycyclic aromatic hydrocarbons (PAHs) in raw cane sugar (rapadura) in Brazil

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Characterization of the Genetic Variability of a Sugarcane Commercial Cross Through Yield Components and Quality Parameters

The phenotypic characterization as well as the knowledge of the correlation among traits, is the first step to quantify the potential of a cross for further QTL (quantitative trait loci) detection. The present work aimed to evaluate the yield components and quality parameters variability of a mapping population derived from a bi-parental cross between IACSP95-3018 and IACSP93-3046 at plant cane and ratoon cane as well as to estimate the heritabilities and pair-wise correlation among the traits evaluated. The progeny clones differed significantly for the traits measures indicating the existence of significant amount of variability among them as also as the presence of transgressive clones. Broad-sense heritabilities values were generally high for stalk diameter, stalk weight, stalk height, Brix and Pol%Cane in plant cane and ratoon cane. Tones of sugarcane per hectare (TCH) were significantly correlated with stalk weight and stalk number in both years. Regarding to all the yield components, stalk number together with stalk weight were the most important components in the determination of TCH. While fiber and Pol%Cane were negative correlated showing that they are inversely correlated traits. © 2012 Society for Sugar Research & Promotion.

Centesimal composition and physical-chemistry analysis of the edible mushroom Lentinus strigosus occurring in the Brazilian Amazon

Avaliou-se a composição centesimal e análise físico-química do Lentinus strigosus, um cogumelo comestível de ocorrência na Amazônia brasileira, produzidos em substratos alternativos à base de resíduos madeireiros e agroindustriais. Com este objetivo, determinou-se C, N, pH, sólidos solúveis, atividade de água, proteína, lipídios, fibra total, cinzas, carboidratos e energia. Os substratos foram formulados a partir de serragem de Simarouba amara Aubl. (marupá), Ochroma piramidale Cav. ex. Lam. (pau-de-balsa) e Anacardium giganteum (cajuí); e do estipe de Bactris gasipaes Kunth (pupunheira) e de Saccharum officinarum (cana-de-açúcar). Os resultados demonstraram que: a composição nutricional do L. strigosus variou com o substrato de cultivo; os valores de proteína encontrados nos cogumelos cultivados nos diferentes substratos (18 - 21,5%) variaram de acordo com o substrato, sendo considerados elevados; os sólidos solúveis presentes nos cogumelos podem ter relação com vitaminas hidrossolúveis do complexo B; o L. strigosus pode ser considerado um importante alimento devido suas características nutricionais: alto teor de proteína, carboidratos metabolizáveis e fibras; baixos teores de lipídios e de calorias.

Different sources of forage with crude glycerin in diets with higher percentage of concentrate to beef cattle

Pós-graduação em Zootecnia - FCAV

Physical characterization of particleboard produced with waste from ethanol and sugar mill

The problem of proper disposal of solid waste generated in different industrial processes is one of worldwide environmental concerns nowadays. Thus, this study aimed to establish a new alternative for the disposal of two agro-industrial residues employing them to produce particleboard for different purposes in building construction. The focus was given to the reuse of the sugarcane bagasse (SB) originated during the processing of Saccharum officinarum for sugar and ethanol production, and bamboo stem leaves of Dendrocalamus giganteus(BB). For this, six particleboards were produced in the following compositions: with 100% SB, 75% SB + 25% BB, 50% SB+50% BB, 40% SB +60 BB, 25% SB+ 75% BB and 100% BB in the total mass of the composites. The particleboards physical characterization followed Brazilian Standard ABNT NBR 14810-3 to density, moisture content and water absorption. Results showed these raw materials are compatible to particleboard production.

Effects of Aspergillus spp. exogenous fibrolytic enzymes on in vitro fermentation of tropical forages

BACKGROUND: Cellulose and hemicellulose are quantitatively the most important structural carbohydrates present in ruminant diets. Rumen micro-organisms produce enzymes that catalyse their hydrolysis, but the complex network formed by structural carbohydrates and lignin reduces their digestibility and restricts efficient utilisation of feeds by ruminants. This study aimed to produce two enzymatic extracts, apply them in ruminant diets to determine the best levels for ruminal digestibility and evaluate their effects on in vitro digestibility. RESULTS: In experiment 1 a two-stage in vitro technique was used to examine the effects of different enzymatic levels of Aspergillus japonicus and Aspergillus terricola on tropical forages. Enzyme addition had minor effects on corn silage at the highest enzymatic level. In experiment 2 an in vitro gas production (GP) technique was applied to determine apparent in vitro organic matter digestibility and metabolisable energy. The addition of enzymes in GP showed interesting results. Good data were obtained using sugar cane and Tifton-85 hay supplemented with extracts of A. japonicus and A. terricola respectively. CONCLUSION: Overall, the study suggests that addition of crude extracts containing exogenous fibrolytic enzymes to ruminant diets enhances the effective utilisation of ruminant feedstuffs such as forages. Copyright (c) 2012 Society of Chemical Industry

Possibilities for the healthy and nutritional improvement of confectionery and sweet products.

The overall objective of this PhD was to investigate the possibility to increase the nutritional value of confectionary products by the use of natural ingredients with healthy functions. The first part of the thesis focused on the possible substitution of the most characteristic component of confectionary products, i.e. refined sugar. Many natural whole sweetening alternatives are available, though not widely used; the use of molasses, the byproduct of sugar beet and cane production, still rich in healthy components as minerals and phytochemicals is hereby discussed; after having verified molasses effectiveness in oxidative stress counteraction on liver cultured cells, the higher antioxidant capacity of a sweet food prepared with molasses instead of refined sugar was confirmed. A second step of the project dealt with another main ingredient of various sweet products, namely wheat. Particularly, the exploitation of soft and durum wheat byproducts could be another sustainable strategy to improve the healthy value of confectionery. The isolation of oligosaccharides with bioactive functions form different fractions of the wheat milling stream was studied and the new ingredients were shown to have a high dietary fiber and antioxidants content. As valid alternative, product developers should consider the appealing and healthy addition of ancient grains flour to sweet baked goods. The possibility of substituting the modern whole durum wheat with the ancient Kamut® khorasan was considered, and the antioxidant and anti-inflammatory effects of these grains were evaluated and compared both in vitro and in vivo on rats. Finally, since high consumption of confectionery is a risk factor for obesity, a possible strategy for the counteraction of this disease was investigated. The ability of three bioactives in inhibiting adipocytes differentiation was investigated. In fact, theoretically, compounds able to influence adipogenesis could be used in the formulation of functional sweet products and contribute to prevent obesity.

Effect of type of fiber, site of fermentation, and method of analysis on digestibility of soluble and insoluble fiber in rabbits

The effect of type of fiber, site of fermetation, method for quantifying insoluble and soluble dietary fiber, and their correction for intestinal mucin on fiber digestibility were examined in rabbits. Three diets differing in soluble fiber were formulated (8.5% soluble fiber, on DM basis, in the low soluble fiber [LSF] diet; 10.2% in the medium soluble fiber [MSF] diet; and 14.5% in the high soluble fiber [HSF] diet). They were obtained by replacing half of the dehydrated alfalfa in the MSF diet with a mixture of beet and apple pulp (HSF diet) or with a mix of oat hulls and soybean protein (LSF diet). Thirty rabbits with ileal T-cannulas were used to determine ileal and fecal digestibility. Cecal digestibility was determined by difference between fecal and ileal digestibility. Insoluble fiber was measured as NDF, insoluble dietary fiber (IDF), and in vitro insoluble fiber, whereas soluble fiber was calculated as the difference between total dietary fiber (TDF) and NDF (TDF_NDF), IDF (TDF-IDF), and in vitro insoluble fiber (TDF-in vitro insoluble fiber). The intestinal mucin content was used to correct the TDF and soluble fiber digestibility. Ileal and fecal concentration of mucin increased from the LSF to the HSF diet group (P < 0.01). Once corrected for intestinal mucin, ileal and fecal digestibility of TDF and soluble fiber increased whereas cecal digestibility decreased (P < 0.01). Ileal digestibility of TDF increased from the LSF to the HSF diet group (12.0 vs. 28.1%; P < 0.01), with no difference in the cecum (26.4%), resulting in a higher fecal digestibility from the LSF to the HSF diet group (P < 0.01). Ileal digestibility of insoluble fiber increased from the LSF to the HSF diet group (11.3 vs. 21.0%; P < 0.01), with no difference in the cecum (13.9%) and no effect of fiber method, resulting in a higher fecal digestibility for rabbits fed the HSF diet compared with the MSF and LSF diets groups (P < 0.01).Fecal digestibility of NDF was higher compared with IDF or in vitro insoluble fiber (P < 0.01). Ileal soluble fiber digestibility was higher for the HSF than for the LSF diet group (43.6 vs. 14.5%; P < 0.01) and fiber method did not affect it. Cecal soluble fiber digestibility decreased from the LSF to the HSF diet group (72.1 vs. 49.2%; P < 0.05). The lowest cecal and fecal soluble fiber digestibility was measured using TDF-NDF (P < 0.01). In conclusion, a correction for intestinal mucin is necessary for ileal TDF and soluble fiber digestibility whereas the selection of the fiber method has a minor relevance. The inclusion of sugar beet and apple pulp increased the amount of TDF fermented in the small intestine.

Sugar and coffee: A history of settler agriculture in nineteenth-century Liberia

This dissertation is about commercial agriculture in nineteenth-century Liberia. Based primarily on the archives of the American Colonization Society (founder of Liberia), it examines the impact of environmental and demographic constraints on an agrarian settler society from 1822 to the 1890s. Contrary to the standard interpretation, which linked the poor state of commercial agriculture to the settlers' disdain for cultivation, this dissertation argues that the scarcity of labor and capital impeded the growth of commercial agriculture. The causes of the scarcity were high mortality, low immigration and the poverty of the American “Negroes” who began to settle Liberia in 1822. ^ Emigration to Liberia meant almost certain death and affliction for many immigrants because they encountered a new set of diseases. Mortality was particularly high during the early decades of colonization. From 1822 to 1843, about 48 percent of all immigrants died of various causes, usually within their first year. The bulk of the deaths is attributed to malaria. There was no natural increase in the population for this early period and because American “Negroes” were unenthusiastic about relocation to Liberia, immigration remained sparse throughout the century. Low immigration, combined with the high death rate, deprived the fledgling colony of its potential human resource, especially for the cultivation of labor-intensive crops, like sugar cane and coffee. Moreover, even though females constituted approximately half of the settlers, they seldom performed agricultural labor. ^ The problem of labor was compounded by the scarcity of draft animals. Liberia is in the region where trypanosomiasis occurs. The disease is fatal to large livestock. Therefore, animal-drawn plows, common in the United States, were never successfully transplanted in Liberia. Besides, the dearth of livestock obstructed the development of the sugar industry since many planters depended on oxen-powered mills because they could not afford to buy the more expensive steam engine mills. ^ Finally, nearly half of the immigrants were newly emancipated slaves. Usually these former bondsmen arrived in Liberia penniless. Consequently, they lacked the capital to invest in large-scale plantations. The other categories of immigrants (e.g., those who purchased their freedom), were hardly better off than the emancipated slaves. ^

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.