986 resultados para microbial pest control


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to evaluate the microbial distribution in the root canal system after periapical lesion induction in dogs' teeth using different methods. Fifty-two root canals were assigned to 4 groups (n=13). Groups I and II: root canals were exposed to the oral cavity for 180 days; groups III and IV: root canals were exposed for 7 days and then the coronal openings were sealed for 53 days. The root apices of groups I and III were perforated, while those of groups II and IV remained intact. After the experimental periods, the animals were euthanized and the anatomic pieces containing the roots were processed and stained with the Brown & Brenn method to assess the presence and distribution of microorganisms. The incidence of microorganisms at different sites of the roots and periapical lesions was analyzed statistically by the chi-square test at 5% significance level. All groups presented microorganisms in the entire root canal system. A larger number of microorganisms was observed on the root canal walls, apical delta and dentinal tubules (p<0.05), followed by cementum and cemental resorption areas. In spite of the different periods of exposure to the oral environment, the methods used for induction of periapical periodontitis yielded similar distribution of microorganisms in the root canal system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: This study evaluated the efficacy of NitrAdineTM-based disinfecting cleaning tablets for complete denture, in terms of denture biofilm removal and antimicrobial action. MATERIAL AND METHODS: Forty complete denture wearers (14 men and 26 women) with a mean age of 62.3±9.0 years were randomly assigned to two groups and were instructed to clean their dentures according to two methods: brushing (control) - 3 times a day with denture brush and tap water following meals; brushing and immersion (Experimental) - brushing the denture 3 times a day with denture brush and tap water following meals and immersion of the denture in NitrAdineTM-based denture tablets (Medical InterporousTM). Each method was used for 21 days. Denture biofilm was disclosed by a 1% neutral red solution and quantified by means of digital photos taken from the internal surface before and after the use of the product. Microbiological assessment was conducted to quantify Candida sp. RESULTS: An independent t-test revealed a significant lower biofilm percentage for the experimental group (4.7, 95% CI 2.4 to 7.9) in comparison with the control group (mean 37.5, 95% CI 28.2 to 48.1) (t38=7.996, p<0.001). A significant reduction of yeast colony forming units could be found after treatment with Medical InterporousTM denture tablets as compared to the control group (Mann-Whitney test, Z=1.90; p<0.05). CONCLUSION: The present findings suggest that NitrAdineTM-based disinfecting cleaning tablets are efficient in removal of denture biofilm. In addition, a clear antimicrobial action was demonstrated. Therefore, they should be recommended as a routine denture maintenance method for the prevention of the development of microbial biofilm induced denture stomatitis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Prosthetic restorations that have been tried in the patient's mouth are potential sources of infection. In order to avoid cross-infection, protocols for infection control should be established in dental office and laboratory. This study evaluated the antimicrobial efficacy of disinfectants on full metal crowns contaminated with microorganisms. Full crowns cast in a Ni-Cr alloy were assigned to one control group (n=6) and 5 experimental groups (n=18). The crowns were placed in flat-bottom glass balloons and were autoclaved. A microbial suspension of each type of strain - S. aureus, P. aeruginosa, S. mutans, E. faecalis and C. albicans- was aseptically added to each experimental group, the crowns being allowed for contamination during 30 min. The contaminated specimens were placed into recipients with the chemical disinfectants (1% and 2% sodium hypochlorite and 2% glutaraldehyde) for 5, 10 and 15 min. Thereafter, the crowns were placed into tubes containing different broths and incubated at 35ºC. The control specimens were contaminated, immersed in distilled water for 20 min and cultured in Thioglycollate broth at 35ºC. Microbial growth assay was performed by qualitative visual examination after 48 h, 7 and 12 days. Microbial growth was noticed only in the control group. In the experimental groups, turbidity of the broths was not observed, regardless of the strains and immersion intervals, thus indicating absence of microbial growth. In conclusion, all chemical disinfectants were effective in preventing microbial growth onto full metal crowns.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Dental erosion is a type of wear caused by non bacterial acids or chelation. There is evidence of a significant increase in the prevalence of dental wear in the deciduous and permanent teeth as a consequence of the frequent intake of acidic foods and drinks, or due to gastric acid which may reach the oral cavity following reflux or vomiting episodes. The presence of acids is a prerequisite for dental erosion, but the erosive wear is complex and depends on the interaction of biological, chemical and behavioral factors. Even though erosion may be defined or described as an isolated process, in clinical situations other wear phenomena are expected to occur concomitantly, such as abrasive wear (which occurs, e.g, due to tooth brushing or mastication). In order to control dental loss due to erosive wear it is crucial to take into account its multifactorial nature, which predisposes some individuals to the condition.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The mechanical control of supragingival biofilm is accepted as one of the most important measures to treat and prevent dental caries and periodontal diseases. Nevertheless, maintaining dental surfaces biofilm-free is not an easy task. In this regard, chemical agents, mainly in the form of mouthwashes, have been studied to help overcome the difficulties involved in the mechanical control of biofilm. The aim of this paper was to discuss proposals for the teaching of supragingival chemical control (SCC) in order to improve dentists' knowledge regarding this clinical issue. Firstly, the literature regarding the efficacy of antiseptics is presented, clearly showing that chemical agents are clinically effective in the reduction of biofilm and gingival inflammation when used as adjuvant agents to mechanical control. Thus, it is suggested that the content related to SCC be included in the curricular grid of dental schools. Secondly, some essential topics are recommended to be included in the teaching of SCC as follows: skills and competencies expected of a graduate dentist regarding SCC; how to include this content in the curricular grid; teaching-learning tools and techniques to be employed; and program content.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To evaluate the effects of the supplementation of feed additives on carcass quality in beef cattle, 72 Nellore steers (339.5kg, 20-month old) were feedlot finished and fed for 91 days one of the following diets: 1) control with no additives; or added of 2) live yeast culture; 3) monensin; or 4) the association of both additives. After slaughter, renal, pelvic, and inguinal fat and hot carcass weights were recorded and carcass was split into muscle, bone, and trimmable fat. Carcass Longissimus muscle area and subcutaneous fat thickness at the 12th rib were measured and steaks of Longisimus muscle were taken to determine meat color, shear force, drip, and cooking losses. Yeast increased carcass dressing percentage but there were no effects on hot carcass weight, Longissimus area, subcutaneous fat thickness, percentage and weight of retail cut yield and trimmings. Feed additives had no effect on carcass pH, meat color, fat content, shear force, and drip losses. Supplementation of yeast, monensin or the association of both additives had no important effects on carcass traits and on meat quality of feedlot finished steers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The arterial partial pressure (P CO2) of carbon dioxide is virtually constant because of the close match between the metabolic production of this gas and its excretion via breathing. Blood gas homeostasis does not rely solely on changes in lung ventilation, but also to a considerable extent on circulatory adjustments that regulate the transport of CO2 from its sites of production to the lungs. The neural mechanisms that coordinate circulatory and ventilatory changes to achieve blood gas homeostasis are the subject of this review. Emphasis will be placed on the control of sympathetic outflow by central chemoreceptors. High levels of CO2 exert an excitatory effect on sympathetic outflow that is mediated by specialized chemoreceptors such as the neurons located in the retrotrapezoid region. In addition, high CO2 causes an aversive awareness in conscious animals, activating wake-promoting pathways such as the noradrenergic neurons. These neuronal groups, which may also be directly activated by brain acidification, have projections that contribute to the CO2-induced rise in breathing and sympathetic outflow. However, since the level of activity of the retrotrapezoid nucleus is regulated by converging inputs from wake-promoting systems, behavior-specific inputs from higher centers and by chemical drive, the main focus of the present manuscript is to review the contribution of central chemoreceptors to the control of autonomic and respiratory mechanisms.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: Despite the relevance of irritability emotions to the treatment, prognosis and classification of psychiatric disorders, the neurobiological basis of this emotional state has been rarely investigated to date. We assessed the brain circuitry underlying personal script-driven irritability in healthy subjects (n = 11) using functional magnetic resonance imaging. METHOD: Blood oxygen level-dependent signal changes were recorded during auditory presentation of personal scripts of irritability in contrast to scripts of happiness or neutral emotional content. Self-rated emotional measurements and skin conductance recordings were also obtained. Images were acquired using a 1,5T magnetic resonance scanner. Brain activation maps were constructed from individual images, and between-condition differences in the mean power of experimental response were identified by using cluster-wise nonparametric tests. RESULTS: Compared to neutral scripts, increased blood oxygen level-dependent signal during irritability scripts was detected in the left subgenual anterior cingulate cortex, and in the left medial, anterolateral and posterolateral dorsal prefrontal cortex (cluster-wise p-value < 0.05). While the involvement of the subgenual cingulate and dorsal anterolateral prefrontal cortices was unique to the irritability state, increased blood oxygen level-dependent signal in dorsomedial and dorsal posterolateral prefrontal regions were also present during happiness induction. CONCLUSION: Irritability induction is associated with functional changes in a limited set of brain regions previously implicated in the mediation of emotional states. Changes in prefrontal and cingulate areas may be related to effortful cognitive control aspects that gain salience during the emergence of irritability.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Diatraea saccharalis (Fabricius, 1794) (Lepidoptera: Crambidae) is an important pest for Brazilian sugarcane. In the present study, we detected two distinct spots in hemolymph from septic injured larvae (HDs1 and HDs2), which are separated by 2DE gel electrophoresis. Both spots were subjected to in-gel tryptic digestion and MALDI-TOF/TOF analysis, which revealed the sequence VFGTLGSDDSGLFGK present in both HDs1 and HDs2. This sequence had homology and 80% identity with specific Lepidoptera antimicrobial peptides called gloverins. Analyses using the ImageMaster 2D software showed pI 8.94 of the HDs1 spot, which is similar to that described to Hyalophora gloveri gloverin (pI 8.5). Moreover, the 14-kDa molecular mass of the spot HDs1 is compatible to that of gloverins isolated from the hemolymph of Trichoplusia ni, Helicoverpa armigera and H. gloveri. Antimicrobial assays with partially purified fractions containing the HDs1 and HDs2 polypeptides demonstrated activity against Escherichia coli. This is the first report of antimicrobial polypeptides in D. saccharalis, and the identification of these peptides may help in the generation of new strategies to control this pest.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: Because autonomic dysfunction has been found to lead to cardiometabolic disorders and because studies have reported that simvastatin treatment has neuroprotective effects, the objective of the present study was to investigate the effects of simvastatin treatment on cardiovascular and autonomic changes in fructose-fed female rats. METHODS: Female Wistar rats were divided into three groups: controls (n=8), fructose (n=8), and fructose+ simvastatin (n=8). Fructose overload was induced by supplementing the drinking water with fructose (100 mg/L, 18 wks). Simvastatin treatment (5 mg/kg/day for 2 wks) was performed by gavage. The arterial pressure was recorded using a data acquisition system. Autonomic control was evaluated by pharmacological blockade. RESULTS: Fructose overload induced an increase in the fasting blood glucose and triglyceride levels and insulin resistance. The constant rate of glucose disappearance during the insulin intolerance test was reduced in the fructose group (3.4+ 0.32%/min) relative to that in the control group (4.4+ 0.29%/min). Fructose+simvastatin rats exhibited increased insulin sensitivity (5.4+0.66%/min). The fructose and fructose+simvastatin groups demonstrated an increase in the mean arterial pressure compared with controls rats (fructose: 124+2 mmHg and fructose+simvastatin: 126 + 3 mmHg vs. controls: 112 + 2 mmHg). The sympathetic effect was enhanced in the fructose group (73 + 7 bpm) compared with that in the control (48 + 7 bpm) and fructose+simvastatin groups (31+8 bpm). The vagal effect was increased in fructose+simvastatin animals (84 + 7 bpm) compared with that in control (49 + 9 bpm) and fructose animals (46+5 bpm). CONCLUSION: Simvastatin treatment improved insulin sensitivity and cardiac autonomic control in an experimental model of metabolic syndrome in female rats. These effects were independent of the improvements in the classical plasma lipid profile and of reductions in arterial pressure. These results support the hypothesis that statins reduce the cardiometabolic risk in females with metabolic syndrome.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Leukemia incidence in children has increased worldwide in recent decades, particularly due to the rise in acute lymphoblastic leukemia. Studies have associated exposure to non-ionizing radiation generated by low frequency magnetic fields with childhood leukemia. The current article reviews the case-control studies published on this subject. Of 152 articles tracked in different databases, ten studies from North America, Asia, and Europe met the defined selection criteria, with patients diagnosed from 1960 to 2004. Methodological limitations were observed in these articles, including difficulties with the procedures for assessing exposure. An association may exist between exposure to low frequency magnetic fields and acute lymphoblastic leukemia in children, but this association is weak, preventing the observation of consistency in the findings. Future studies from a wider range of geographic regions should focus on the analysis of acute lymphoblastic leukemia, which is the subtype with the greatest impact on the increasing overall incidence of childhood leukemia.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cardiovascular diseases (CVD) are the main causes of death in the Western world. Among the risk factors that are modifiable by diet, for reducing cardiovascular disease risks, the total plasma concentrations of cholesterol, triglycerides, LDL-C, and HDL-C are the most important. Dietary measures can balance these components of the lipid profile thus reducing the risk of cardiovascular diseases. The main food components that affect the lipid profile and can be modified by diet are the saturated and trans fats, unsaturated fats, cholesterol, phytosterols, plant protein, and soluble fiber. A wealth of evidence suggests that saturated and trans fats and cholesterol in the diet raise the total plasma cholesterol and LDL-C. Trans fats also reduce HDL-C, an important lipoprotein for mediating the reverse cholesterol transport. On the other hand, phytosterols, plant proteins, isoflavones, and soluble fiber are protective diet factors against cardiovascular diseases by modulating plasma lipoprotein levels. These food components at certain concentrations are able to reduce the total cholesterol, TG, and LDL-C and raise the plasma levels of HDL-C. Therefore, diet is an important tool for the prevention and control of cardiovascular diseases, and should be taken into account as a whole, i.e., not only the food components that modulate plasma concentrations of lipoproteins, but also the diet content of macro nutrients and micronutrients should be considered.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A case-control study was carried out in litters of 1 to 7-day-old piglets to identify the main infectious agents involved with neonatal diarrhea in pigs. Fecal samples (n=276) from piglets were collected on pig farms in the State of Rio Grande do Sul, Brazil, from May to September 2007. Litters with diarrhea were considered cases (n=129) and normal litters (n=147) controls. The samples were examined by latex agglutination test, PAGE, conventional isolating techniques, ELISA, PCR, and microscopic methods in order to detect rotavirus, bacterial pathogens (Escherichia coli, Clostridium perfringens type A and C, and Clostridium difficile), and parasites (Coccidian and Cryptosporidium spp.). Outbreaks of diarrhea were not observed during sampling. At least one agent was detected in fecal samples on 25 out of 28 farms (89.3%) and in 16 farms (57.1%) more than one agent was found. The main agents diagnosed were Coccidia (42.86%) and rotavirus (39.29%). The main agents identified in litters with diarrhea were Clostridium difficile (10.6%), Clostridium perfringens type A (8.8%) and rotavirus (7.5%); in control litters, Clostridium difficile (16.6%) and Coccidian (8.5%). Beta hemolytic Escherichia coli and Clostridium perfringens type C were not detected. When compared with controls, no agent was significantly associated with diarrhea in case litters. These findings stress the need for caution in the interpretation of laboratorial diagnosis of mild diarrhea in neonatal pigs, as the sole detection of an agent does not necessarily indicate that it is the cause of the problem.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Identification of animals that are decomposing or have been run over or burnt and cannot be visually identified is a problem in the surveillance and control of infectious diseases. Many of these animals are wild and represent a valuable source of information for epidemiologic research as they may be carriers of an infectious agent. This article discusses the results obtained using a method for identifying mammals genetically by sequencing their mitochondrial DNA control region. Fourteen species were analyzed and identified. These included the main reservoirs and transmitters of rabies virus, namely, canids, chiroptera and primates. The results prove that this method of genetic identification is both efficient and simple and that it can be used in the surveillance of infectious diseases which includes mammals in their epidemiologic cycle, such as rabies.