1000 resultados para controle de patógenos do solo
Resumo:
The objectives of this work was to estimate the number of soil subsamples considering the classical statistics and geostatistics and determine the spatial variability of soil fertility attributes of an Ultisol, with clay texture, in an area of regenerating natural vegetation in Alegre - ES. Soil samples were collected in a depth of 0.0-0.2 m, at the crossing points of a regular grid, comprising a total of 64 points located at 10 m-intervals. The area presented low fertility soil. Considering a variation of 5% around the mean in the classic statistics, it is necessary a larger number of samples in relation to geostatistics. All the chemical attributes showed moderate to high spatial dependence, except for the effective cation exchange capacity (CECe), which showed pure nugget effect. The spherical semivariogram model gave the best fit to the data. Isoline maps allowed visualizing the differentiated spatial distribution of the contents of soil chemical attributes.
Resumo:
In Brazil the adoption of several models of cattle confinement leads to special conditions for management methods in dairy production, which can be improved by the use of technology that assures better herd management. Indexes relating environmental variables to production are applied for the prediction of milk production. The values of temperature and relative humidity, rain index, solar radiation and pasture soil temperature are generally considered potential stress agents for cows. The objective of this research was to develop an index for predicting milk production for high productivity Jersey milking cows lodged in semi confinement in tropical conditions. The experiment considered two treatments: A - the cows waited for 30 minutes prior to milking in a room with a shower associated to a fan; B - the cows did not have access to this room (control). Other than the waiting period, the cows had access to pasture. Differences in the effect of average production were not statistically significant. The analysis for studying the effect of the variables and designing the model led to a statistical model relating the variables milk production and rain index, as well as the maximum soil temperature of pasture, and milk production.
Resumo:
This work was done with the objective of studying some physical and mechanical characteristics of the sugarcane bagasse ash added to a soil-cement mixture, in order to obtain an alternative construction material. The sugarcane bagasse ash pre-treatment included both sieving and grinding, before mixing with soil and cement. Different proportions of cement-ash were tested by determining its standard consistence and its compressive resistance at 7 and 28 days age. The various treatments were subsequently applied to the specimens molded with different soil-cement-ash mixtures which in turns were submitted to compaction, unconfined compression and water absorption laboratory tests. The results showed that it is possible to replace up to 20% of Portland cement by sugarcane bagasse ash without any damage to the mixture's compressive strength.
Resumo:
The physical model was based on the method of Newton-Euler. The model was developed by using the scientific computer program Mathematica®. Several simulations where tried varying the progress speeds (0.69; 1.12; 1.48; 1.82 and 2.12 m s-1); soil profiles (sinoidal, ascending and descending ramp) and height of the profile (0.025 and 0.05 m) to obtain the normal force of soil reaction. After the initial simulations, the mechanism was optimized using the scientific computer program Matlab® having as criterion (function-objective) the minimization of the normal force of reaction of the profile (FN). The project variables were the lengths of the bars (L1y, L2, l3 and L4), height of the operation (L7), the initial length of the spring (Lmo) and the elastic constant of the spring (k t). The lack of robustness of the mechanism in relation to the variable height of the operation was outlined by using a spring with low rigidity and large length. The results demonstrated that the mechanism optimized showed better flotation performance in relation to the initial mechanism.
Resumo:
The covering of the soil is an agricultural practice that intends to control the harmful herbs, to reduce the losses of water by evaporation of the soil, and to facilitate the harvest and the commercialization, once the product is cleaner and healthier. However, when the soil is covered important microclimatic parameters are also altered, and consequently the germination of seeds, the growth of roots, the absorption of water and nutrients, the metabolic activity of the plants and the carbohydrates storage. The current trial intended to evaluate the effect of soil covering with blue colored film on consumptive water-use in a lettuce crop (Lactuca sativa, L.). The experiment was carried out in a plastic greenhouse in Araras - São Paulo State, Brazil from March 3rd, 2001 to May 5th, 2001. The consumptive water-use was measured through two weighing lysimeter installed inside the greenhouse. Crop spacing was 0.25 m x 0.25 m and the color of the film above soil was blue. Leaf area index (IAF), was measured six times (7; 14; 21; 28; 35; 40 days after transplant) and the water-use efficiency (EU) was measured at the end. The experimental design was subdivided portions with two treatments, bare soil and covered soil. The average consumptive water-use was 4.17 mm day-1 to the bare soil treatment and 3.11 mm day-1 to the covered soil treatment. The final leaf area index was 25.23 to the bare soil treatment and 24.39 to the covered soil treatment, and there was no statistical difference between then.
Resumo:
The main objective of this work is the study of the effect of rice husk addition on the physical and mechanical properties of soil-cement, in order to obtain an alternative construction material. The rice husk preparation consisted of grinding, sieving, and the pre-treatment with lime solution. The physical characteristics of the soil and of the rice husk were determined. Different amounts of soil, cement and rice husk were tested by compaction and unconfined compression. The specimens molded according to the treatments applied to the mixtures were subsequently submitted to compression testing and to tensile splitting cylinder testing at 7 and 28 days of age and to water absorption testing. After determining its physical and mechanical characteristics, the best results were obtained for the soil + 12% (cement + rice husk) mixture. The results showed a promising use as an alternative construction material.
Resumo:
Time Domain Reflectometry (TDR) is a reliable method for in-situ measurements of the humidity and the solution concentration at the same soil volume. Accurate interpretation of electrical conductivity (and soil humidity) measurements may require a specific calibration curve. The primary goal of this work was to establish a calibration procedure for using TDR to estimate potassium nitrate concentrations (KNO3) in soil solution. An equation relating the electrical conductivity measured by TDR and KNO3 concentration was established enabling the use of TDR technique to estimate soil water content and nitrate concentration for efficient fertigation management.
Resumo:
This paper presents the behavior of three bored piles conducted in diabasic soil submitted to uplift forces. The piles were built at the site for Experimental Studies in Soil Mechanics and Foundations of UNICAMP, located in the city of Campinas, Brazil. Field tests have already been conducted at the site (SPT, CPT, DMT and PMT), as well as laboratory tests by using sample soils taken from a well up to 17 m deep. The water table is not checked until a depth of 17 m. In order to check the behavior of the piles when submitted to uplift forces, slow static load tests were carried out as the recommendations of NBR 12131. The carrying capacity of these piles was also provided by means of theoretical methods, appropriate for uplift forces, and through semi-empirical methods appropriate for compression forces, considering only the portion of lateral resistance. The values estimated by using the considered methods were compared to those obtained by means of load tests. One of the tested piles was extracted from the soil to be the subject of a study on its geometry.
Resumo:
This paper describes the development of a relational database and a tool for viewing MODIS NDVI temporal profile, using data from MOD09Q1 product, specifically the surface bidirectional reflectance factor relative to the RED and NIR wavelength, mosaic of 8-day temporal composition, and the quality band, in sugarcane fields in the state of São Paulo, for analysis of the late stubble-cane maturation. From sugarcane farms were obtained the historical data about yield, soil, variety, location of the each pixel for each subregion monitored. All data were integrated in a database developed in PostgreSQL. The tool was implemented using Java language and allowed a fast and automatic way of analyzing sugarcane phenological patterns. It concluded that the MODIS NDVI temporal profile using data from MOD09Q1 product is able to subsidize the monitoring of phenological changes in the sugarcane.
Resumo:
The objective of this study was to quantify the effect of plonk on compressive behavior and mechanical attributes such as consistency, optimum moisture for compaction and maximum density of a Red-Yellow Latosol (Oxisol) to evaluate the effect of plonk and compaction state in splashed particles, from Lavras (MG) region. The plonk was obtained from an artisanal sugarcane brandy alembic. Undisturbed and disturbed soil samples were collected at 0 to 3 cm and 60 to 63 cm depths. Disturbed soil samples were used for soil characterization, determination of consistence limits and Normal Proctor essay after material incubation with plonk. Undisturbed soil samples were saturated with plonk or distilled water (control) during 48 hours for testing the compressibility and resistance to splash by using simulated rainfall. The plonk altered the consistence limits of studied layers. For the 0-3 cm layer, the plonk reduced the friable range, and for the 60-63 cm layer the effect was in the opposite direction. For both layers, the plonk increased Dmax and decreased Uoptimum. Regardless of the plonk treatment, both layers presented the same load support capacity. The compaction degree of samples influenced the splash erosion. The increase of the applied pressure over the samples resulted in increase of splash material quantity. At the 60-63 cm layer, the plonk treatment reduced the splash material quantity by increasing the applied pressure, mainly when the samples were at field capacity.
Resumo:
The aim of this study was to test fear, anxiety and control related to dental treatment. The subjects were 364 children with ages between 7 and 13 years. Three questionnaires with multiple choice questions were applied in groups of 10 children. The first instrument was the 15-item dental subscale from the Childrens Fear Survey Schedule9. The subjects rated their level of fear on a 5-point scale. The second survey instrument was the 20-item subscale from the State Trait Anxiety Inventory for Children16. This measure was used to capture how anxious the child was, in general. The third instrument was the Child Dental Control Assessment19. It contained 20 items to assess perceived control and 20 items to assess desired control. The results of the survey indicated that dental fear and anxiety were slightly higher for females when compared with male subjects (P < 0.05). Older children (11 to 13 years old) obtained higher fear scores than younger ones (7 to 9 years old). Concerning perceived control, the results indicate that younger children perceive more control than older ones. For desired control, the results indicate that younger children reported higher percentages than older ones. In this study, patients who had undergone anesthesia during treatment revealed higher fear scores when compared with those who had not. Dental fear etiology seems to be related to a procedure that may involve pain or lack of control.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física