Two forms of methionyl-transfer RNA synthetase from Mycobacterium Smegmatis

Two methionyl-transfer RNA synthetases (A and B forms) have been isolated from Image . The homogeneous preparations of the enzymes showed 1500 fold increase in specific activity in aminoacylation of methionine specific tRNA. The A and B forms differed in their specificity of aminoacylation of tRNAmMet and tRNAfMet; enzyme B exhibited much higher specificity for tRNAfMet. The molecular activities of A and B enzymes for aminoacid and tRNA were identical. The turnover number for aminoacid was 27 fold greater than that for tRNA, while the Km values for tRNA were lower by a factor of 106 as compared to the aminoacid. Both the enzymes catalysed ATP-pyrophosphate exchange reaction to the same extent.

Sequence of reactions leading to cytochrome-p-450 synthesis-effect of drugs

The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.

Sequence distribution in Acrylonitrile-methylacrylate random copolymers by N.M.R spectroscopy

The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%sequences is indicated by the pattern of a-methyl protons.

Immunological studies on nucleic-acids and their components .5. Antibodies specific to a deoxyribodinucleotide sequence

Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.

Tributyltin chloride-sodium cyanoborohydride mediated tandem radical cyclisation-reductive demethoxylation sequence

Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Characterization of sequence and structural features of the Candida krusei Enolase

The incidence of human infections by the fungal pathogen Candida species has been increasing in recent years. Enolase is an essential protein in fungal metabolism. Sequence data is available for human and a number of medically important fungal species. An understanding of the structural and functional features of fungal enolases may provide the structural basis for their use as a target for the development of new anti-fungal drugs. We have obtained the sequence of the enolase of Candida krusei (C. krusei), as it is a significant medically important fungal pathogen. We have then used multiple sequence alignments with various enolase isoforms in order to identify C. krusei specific amino acid residues. The phylogenetic tree of enolases shows that the C. krusei enolase assembles on the tree with the fungal genes. Importantly, C. krusei lacks four amino acids in the active site compared to human enolase, as revealed by multiple sequence alignments. These differences in the substrate binding site may be exploited for the design of new anti-fungal drugs to selectively block this enzyme. The lack of the important amino acids in the active site also indicates that C. krusei enolase might have evolved as a member of a mechanistically diverse enolase superfamily catalying somewhat different reactions.

Specific polyadenylation and purification of total messenger RNA from Escherichia coli

Obtaining pure mRNA preparations from prokaryotes has been difficult, if not impossible, for want of a poly(A) tail on these messages, We have used poly(A) polymerase from yeast to effect specific polyadenylation of Escherichia coli polysomal mRNA in the presence of magnesium and manganese, The polyadenylated total mRNA, which could be subsequently purified by binding to and elution from oligo(dT) beads, had a size range of 0.4-4.0 kb. We have used hybridization to a specific plasmid-encoded gene to further confirm that the polyadenylated species represented mRNA, Withdrawal of Mg2+ from the polyadenylation reaction rRNA despite the presence of Mn2+, indicating the vital role of Mg2+ in maintaining the native structure of polysomes, Complete dissociation of polysomes into ribosomal subunits resulted in quantitative polyadenylation of both 16S and 23S rRNA species, Chromosomal lacZ gene-derived messages were quantitatively recovered in the oligo(dT)-bound fraction, as demonstrated by RT-PCR analysis, Potential advantages that accrue from the availability of pure total mRNA from prokaryotes is discussed.

A common epitope of beta-lactoglobulin and serum retinol-binding proteins: Elucidation of its core sequence using synthetic peptides

One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.

Comparative sequence analysis and expression in E-coli of the subgroup I-specific antigen VP6 from a G2 serotype human rotavirus IS2

VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.

Structure of Sesbania mosaic virus at 3 angstrom resolution

Sesbania mosaic virus (SMV) is an isometric, ss-RNA plant virus found infecting Sesbania grandiflora plants in fields near Tirupathi, South India. The virus particles, which sediment at 116 S at pH 5.5, swell upon treatment with EDTA at pH 7.5 resulting in the reduction of the sedimentation coefficient to 108 S. SMV coat protein amino acid sequence was determined and found to have approximately 60% amino acid sequence identity with that of southern bean mosaic virus (SBMV). The amino terminal 60 residue segment, which contains a number of positively charged residues, is less well conserved between SMV and SBMV when compared to the rest of the sequence. The 3D structure of SMV was determined at 3.0 Å resolution by molecular replacement techniques using SBMV structure as the initial phasing model. The icosahedral asymmetric unit was found to contain four calcium ions occurring in inter subunit interfaces and three protein subunits, designated A, B and C. The conformation of the C subunit appears to be different from those of A and B in several segments of the polypeptide. These observations coupled with structural studies on SMV partially depleted of calcium suggest a plausible mechanisms for the initiation of the disassembly of the virus capsid.

The genome packaging machinery of dsDNA bacteriophage PRD1

Viral genomes are encapsidated within protective protein shells. This encapsidation can be achieved either by a co-condensation reaction of the nucleic acid and coat proteins, or by first forming empty viral particles which are subsequently packaged with nucleic acid, the latter mechanism being typical for many dsDNA bacteriophages. Bacteriophage PRD1 is an icosahedral, non-tailed dsDNA virus that has an internal lipid membrane, the hallmark of the Tectiviridae family. Although PRD1 has been known to assemble empty particles into which the genome is subsequently packaged, the mechanism for this has been unknown, and there has been no evidence for a separate packaging vertex, similar to the portal structures used for packaging in the tailed bacteriophages and herpesviruses. In this study, a unique DNA packaging vertex was identified for PRD1, containing the packaging ATPase P9, packaging factor P6 and two small membrane proteins, P20 and P22, extending the packaging vertex to the internal membrane. Lack of small membrane protein P20 was shown to totally abolish packaging, making it an essential part of the PRD1 packaging mechanism. The minor capsid proteins P6 was shown to be an important packaging factor, its absence leading to greatly reduced packaging efficiency. An in vitro DNA packaging mechanism consisting of recombinant packaging ATPase P9, empty procapsids and mutant PRD1 DNA with a LacZ-insert was developed for the analysis of PRD1 packaging, the first such system ever for a virus containing an internal membrane. A new tectiviral sequence, a linear plasmid called pBClin15, was identified in Bacillus cereus, providing material for sequence analysis of the tectiviruses. Analysis of PRD1 P9 and other putative tectiviral ATPase sequences revealed several conserved sequence motifs, among them a new tectiviral packaging ATPase motif. Mutagenesis studies on PRD1 P9 were used to confirm the significance of the motifs. P9-type putative ATPase sequences carrying a similar sequence motif were identified in several other membrane containing dsDNA viruses of bacterial, archaeal and eukaryotic hosts, suggesting that these viruses may have similar packaging mechanisms. Interestingly, almost the same set of viruses that were found to have similar putative packaging ATPases had earlier been found to share similar coat protein folds and capsid structures, and a common origin for these viruses had been suggested. The finding in this study of similar packaging proteins further supports the idea that these viruses are descendants of a common ancestor.

A promoter-level mammalian expression atlas

Regulated transcription controls the diversity, developmental pathways and spatial organization of the hundreds of cell types that make up a mammal. Using single-molecule cDNA sequencing, we mapped transcription start sites (TSSs) and their usage in human and mouse primary cells, cell lines and tissues to produce a comprehensive overview of mammalian gene expression across the human body. We find that few genes are truly 'housekeeping', whereas many mammalian promoters are composite entities composed of several closely separated TSSs, with independent cell-type-specific expression profiles. TSSs specific to different cell types evolve at different rates, whereas promoters of broadly expressed genes are the most conserved. Promoter-based expression analysis reveals key transcription factors defining cell states and links them to binding-site motifs. The functions of identified novel transcripts can be predicted by coexpression and sample ontology enrichment analyses. The functional annotation of the mammalian genome 5 (FANTOM5) project provides comprehensive expression profiles and functional annotation of mammalian cell-type-specific transcriptomes with wide applications in biomedical research.