909 resultados para Talking bodies
Resumo:
To find examples of effecient locomotion and manoeuvrability, one need only turn to the elegant solutions natural flyers and swimmers have converged upon. This dissertation is specifically motivated by processes of evolutionary convergence, which have led to the propulsors and body shapes in nature that exhibit strong geometric collapse over diverse scales. These body features are abstracted in the studies presented herein using low-aspect-ratio at plates and a three-dimensional body of revolution (a sphere). The highly-separated vortical wakes that develop during accelerations are systematically characterized as a function of planform shape, aspect ratio, Reynolds number, and initial boundary conditions. To this end, force measurements and time-resolved (planar) particle image velocimetry have been used throughout to quantify the instantaneous forces and vortex evolution in the wake of the bluff bodies. During rectilinear motions, the wake development for the flat plates is primarily dependent on plate aspect ratio, with edge discontinuities and curvature playing only a secondary role. Furthermore, the axisymmetric case, i.e. the circular plate, shows strong sensitivity to Reynolds number, while this sensitivity quickly diminishes with increasing aspect ratio. For rotational motions, global insensitivity to plate aspect ratio has been observed. For the sphere, it has been shown that accelerations play an important role in the mitigation of flow separation. These results - expounded upon in this dissertation - have begun to shed light on the specific vortex dynamics that may be coopted by flying and swimming species of all shapes and sizes towards efficient locomotion.
Resumo:
This paper refers to a crucial issue for higher education institutions. In Mexico, particularly, the collective work of academic bodies is an unresolved issue despite the efforts made in this regard. In this context, a well-founded systematic discussion is essential to understand the potential of these academic bodies on faculty strengthening and their subsequent impact on the quality of education. This paper presents the results of a research project conducted by FIME with the purpose of identifying the characteristics of its academic bodies as well as their current and potential condition. (1) Translator’s Note: FIME refers to the Facultad de Ingeniería Mecánica y Eléctrica (College of Mechanical and Electrical Engineering).
Resumo:
Psychology is a central part of undergraduate nursing curricula in the UK. However, student nurses report difficulties recognising the relevance and value of psychology. We sought to strengthen first-year student nurses’ application of psychology by developing a set of digital stories based around ‘Talking Head’ video clips where authentic patients relate their experiences of illness and nursing care. The aim of this article is to discuss the technological, organisational and pedagogical challenges, student and staff evaluations and our recommendations for the future of Talking Heads. First-year student nurses were shown a video clip of a patient talking about their illness experiences followed by a group learning situation linking main themes to psychology and nursing. Students and staff valued the authenticity of patient's narrative, found the video clip easy to follow, reported a raised awareness of psychological concepts and improved empathetic understanding of chronic illness. Negative evaluations were related to a sanitised, untypical representation and limited internet access. This small-scale study highlighted how patient narrative may enhance students understanding of illness experience. It chronicles the development and evaluation of a Talking Head in a specific context but which may be useful across disciplines.
Resumo:
The navigation of deep space spacecraft requires accurate measurement of the probe’s state and attitude with respect to a body whose ephemerides may not be known with good accuracy. The heliocentric state of the spacecraft is estimated through radiometric techniques (ranging, Doppler, and Delta-DOR), while optical observables can be introduced to improve the uncertainty in the relative position and attitude with respect to the target body. In this study, we analyze how simulated optical observables affect the estimation of parameters in an orbit determination problem, considering the case of the ESA’s Hera mission towards the binary asteroid system composed of Didymos and Dimorphos. To this extent, a shape model and a photometric function are used to create synthetic onboard camera images. Then, using a stereophotoclinometry technique on some of the simulated images, we create a database of maplets that describe the 3D geometry of the surface around a set of landmarks. The matching of maplets with the simulated images provides the optical observables, expressed as pixel coordinates in the camera frame, which are fed to an orbit determination filter to estimate a certain number of solve-for parameters. The noise introduced in the output optical observables by the image processing can be quantified using as a metric the quality of the residuals, which is used to fine-tune the maplet-matching parameters. In particular, the best results are obtained when using small maplets, with high correlation coefficients and occupation factors.
Resumo:
Il presente studio mira all’esposizione della proposta di traduzione di due capitoli tratti dal saggio “Translating into Democracy” di Anna Bogic, inserito all’interno del volume “Translating Women. Different Voices and New Horizons” editato da Luise von Flotow e Farzaneh Farahzad. I capitoli in esame si intitolano rispettivamente “Our Bodies, Ourselves in the United States” e “The Politics of Translation and the ‘Other’ Europe”. Attraverso la presentazione del testo tradotto, l’elaborato riflette sul percorso editoriale di Our Bodies, Ourselves, opera di fondamentale rilevanza nata nel corso della seconda ondata femminista. Successivamente all’analisi dei contenuti del libro, il discorso fa luce sulle dinamiche di diffusione del sapere attraverso i flussi traduttivi adottando l’ottica dello schema “centro-periferia” teorizzato da Immanuel Wallerstein. Inoltre, l’elaborato propone un’analisi del testo di partenza attraverso il metodo funzionale, identificando le principali componenti che costituiscono la comunicazione testuale: il genere testuale, il mittente, lo stile linguistico e lo skopos. Successivamente, il discorso analitico individua i diversi generi di problemi traduttivi, distinguendoli in problemi pragmatici, problemi legati alle convenzioni e problemi linguistici, che vengono esplicati attraverso l’esposizione di esempi tratti direttamente dal testo originale e dalla sua versione tradotta. Infine, l’elaborato riflette sull’impatto socioculturale di “Our Bodies, Ourselves” ed evidenzia l’importanza del coordinamento femminista internazionale alla base dell’intero flusso traduttivo che ha interessato l’opera.
Resumo:
“Culture has been, is and always will be useful to the political and social fight, precisely because it stirs consciences and prompts reflection”, stated Pero Di Blasio, producer of the Italian version of the musical Everybody’s Talking About Jamie in our private interview (Savoia, 2022). And the invitation for reflection mentioned by the producer represents the main topic of my dissertation, as its aim is to underline, starting from a translation point of view, the differences and similarities conveyed by the two versions of the musical, to raise awareness and spread validation towards the issues and struggles members of the LGBTQIA+ community are forced to face every day. The four chapters in which this dissertation is divided into proceed from a more generic and theoretical one (chapter 1), followed by the introduction of the musical in Chapter 2 with its British and Italian versions, contextualised in their national realities thanks to their press reviews. Then the focus will zoom into the more practical chapters, where the topic of the Italian translation will be gradually approached. The dissertation will then be concluded with the fourth chapter, where the findings identified in the third chapter will be commented, taking into consideration the audience perception and the social issues portrayed on stage by the cast of the West End musical.
Resumo:
Caffeine has already been used as an indicator of anthropogenic impacts, especially the ones related to the disposal of sewage in water bodies. In this work, the presence of caffeine has been correlated with the estrogenic activity of water samples measured using the BLYES assay. After testing 96 surface water samples, it was concluded that caffeine can be used to prioritize samples to be tested for estrogenic activity in water quality programs evaluating emerging contaminants with endocrine disruptor activity.
Resumo:
Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.
Resumo:
This work describes the evaluation of metals and (metallo)proteins in vitreous humor samples and their correlations with some biological aspects in different post-mortem intervals (1-7 days), taking into account both decomposing and non-decomposing bodies. After qualitative evaluation of the samples involving 26 elements, representative metal ions (Fe, Mg and Mo) are determined by inductively coupled plasma mass spectrometry after using mini-vial decomposition system for sample preparation. A significant trend for Fe is found with post-mortem time for decomposing bodies because of a significant increase of iron concentration when comparing samples from bodies presenting 3 and 7 days post-mortem interval. An important clue to elucidate the role of metals is the coupling of liquid chromatography with inductively coupled plasma mass spectrometry for identification of metals linked to proteins, as well as mass spectrometry for the identification of those proteins involved in the post-mortem interval.
Resumo:
Spores of the tropical mosses Pyrrhobryum spiniforme, Neckeropsis undulata and N. disticha were characterized regarding size, number per capsule and viability. Chemical substances were analyzed for P. spiniforme and N. undulata spores. Length of sporophyte seta (spore dispersal ability) was analyzed for P. spiniforme. Four to six colonies per species in each site (lowland and highland areas of an Atlantic Forest; Serra do Mar State Park, Brazil) were visited for the collection of capsules (2008 - 2009). Neckeropsis undulata in the highland area produced the largest spores (ca. 19 µm) with the highest viability. The smallest spores were found in N. disticha in the lowland (ca. 13 µm). Pyrrhobryum spiniforme produced more spores per capsule in the highland (ca. 150,000) than in lowland (ca. 40,000); longer sporophytic setae in the lowland (ca. 64 mm) than in the highland (ca. 43 mm); and similar sized spores in both areas (ca. 16 µm). Spores of N. undulata and P. spiniforme contained lipids and proteins in the cytoplasm, and acid/neutral lipids and pectins in the wall. Lipid bodies were larger in N. undulata than in P. spiniforme. No starch was recorded for spores. Pyrrhobryum spiniforme in the highland area, different from lowland, was characterized by low reproductive effort, but presented many spores per capsule.
Resumo:
Annatto seeds do not germinate during early stages of their development because of insufficient reserve substances. In situ analysis showed that the principal reserves are proteins and starch, deposited in endosperm cells. During the early stages of development, the starch grains were elliptic, because amylose was the minor component. During development, these grains became more spherical due to an increase in amylose relative to amylopectin. Endosperm cells do not contain protein bodies, but they accumulate proteins dispersed in the cytoplasm. At the final stage of development the proteins became compacted due to the dehydration of the seeds wich is part of the global process of orthodox seeds maturation. Natural fluorescence revealed aromatic amino acids, principally tryptophan and tyrosine in the proteins. The seeds reached their maximum dry weight after moisture contents had declined to around 60%. At this point the seeds presented maximum germination capacity.
Resumo:
Our aim was to verify the influence of a physical activities proposal in the quality of life and self image of incontinent women. This study was comparative and exploratory and was developed in 16 weeks. Thirty-seven women with and without urinary incontinence (IU) participated in the study. After the study, significant improvement in general health perception (p < 0.001), UI impact (p = 0.035), physical limitations (p = 0.015), personal relations, (p = 0.048), sleep and disposition (p = 0.012) and concerned with the gravity measurements (p = 0.011) was observed. Concerning self image, alterations in appearance were not observed; however, concerning body satisfaction, the women felt less satisfied with their bodies (p = 0.007). There was a reduction in the number of regions where they felt pain (p = 0.0003) and that they did not like (p = 0.0017). In conclusion, the Physical Education professionals using a systematized and integrated physical activities program can lead the women with IU to significant improvement in the perception of their quality of life and health concerning their self image with improvement of the IU symptoms and reduction of frequency and amount of urinary loss.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
A case of neuronal ceroid-lipofuscinosis (NCL) is reported in a 11-year-old girl, whose main symptoms were progressive dementia since the age of 4 years and choreic movements since age 10. Seizures, myoclonus and visual deterioration were absent and optic fundi were normal. A cerebral biopsy disclosed two basic types of stored substance in the cytoplasm of neurons: a) severely balloned nerve cells in cortical layers HI and V contained a non-autofluorescent material, which stained with PAS and Sudan Black B in frozen, but not in paraffin sections; ultrastructurally, these neurons showed abundant corpuscles similar to the membranous cytoplasmic bodies of Tay-Sachs disease and, in smaller amounts, also zebra bodies; b) slightly distended or non-distended neurons in all layers contained lipopigment granules, which were autofluorescent, PAS-positive and sudanophil in both frozen and paraffin sections; their ultrastructure was closely comparable to that of lipofuscin. Similar bodies were found in the swollen segments of axons and in a few astrocytes and endothelial cells. The histochemical and ultrastructural demonstration of large amounts of lipopigments allows a presumptive classification of the case as NCL. However, the presence of involuntary movements, the absence of visual disturbances and the unusual ultrastructural features place the patient into a small heterogeneous group within the NCL. A better classification of such unique instances of the disease must await elucidation of the basic enzymatic defects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física