Use of conventional PCR and smear microscopy to diagnose pulmonary tuberculosis in the Amazonian rainforest area

The diagnostic usefulness of Ziehl-Neelsen (ZN)-stained sputum smears combined with conventional polymerase chain reaction (ZN/PCR) to amplify IS6110 region DNA extracted from ZN slides was evaluated. The objective was to verify if this association could improve tuberculosis (TB) diagnosis in patients at remote sites. The study was carried out in 89 patients with culture-confirmed pulmonary TB as defined by the Brazilian Manual for TB Treatment. The participants were recruited in a reference unit for TB treatment in Rondônia, a state in the Amazonian area in northern Brazil. ZN, PCR, and culture performed in the sputum samples from these patients were analyzed in different combinations (i.e., ZN plus PCR and ZN plus culture). The prevalence rates of pulmonary TB in these patients were 32.6 and 28.1% considering culture and ZN/PCR, respectively. The sensitivity and specificity of ZN/PCR were 86 and 93%, respectively. ZN/PCR was able to detect more TB cases than ZN alone. This method could offer a new approach for accurate tuberculosis diagnosis, especially in remote regions of the world where culture is not available.

Biological significance of miR-126 expression in atrial fibrillation and heart failure

We investigated the biological significance of microRNA-126 (miR-126) expression in patients with atrial fibrillation (AF) and/or heart failure (HF) to examine the possible mechanism of miR-126-dependent AF and development of HF. A total of 103 patients were divided into three groups: AF group (18 men and 17 women, mean age: 65.62±12.72 years), HF group (17 men and 15 women, mean age: 63.95±19.71 years), and HF-AF group (20 men and 16 women, mean age: 66.56±14.37 years). Quantitative real-time PCR was used to measure relative miR-126 expression as calculated by the 2−ΔΔCt method. miR-126 was frequently downregulated in the 3 patient groups compared with controls. This reduction was significantly lower in permanent and persistent AF patients than in those with paroxysmal AF (P<0.05, t-test). Moreover, miR-126 expression was markedly lower in the HF-AF group compared with the AF and HF groups. The 3 patient groups had higher N-terminal prohormone brain natriuretic peptide (NT-proBNP) levels, lower left ventricular ejection fraction (LVEF), larger left atrial diameter, and higher cardiothoracic ratio compared with controls. There were significant differences in NT-proBNP levels and LVEF among the AF, HF, and HF-AF groups. Pearson correlation analysis showed that relative miR-126 expression was positively associated with LVEF, logarithm of NT-proBNP, left atrial diameter, cardiothoracic ratio, and age in HF-AF patients. Multiple linear regression analysis showed that miR-126 expression was positively correlated with LVEF, but negatively correlated with the logarithm of NT-pro BNP and the cardiothoracic ratio (all P<0.05). Serum miR-126 levels could serve as a potential candidate biomarker for evaluating the severity of AF and HF. However, to confirm these results, future studies with a larger and diverse patient population are necessary.

Discriminação de sorovares de Salmonella spp. isolados de carcaças de frango por REP e ERIC-PCR e fagotipagem do sorovar Enteriditis

Salmonelose é a infecção bacteriana de origem alimentar mais freqüente no Paraná, Brasil, e os surtos estão associados, principalmente, ao consumo de ovos, carne de aves e derivados. Os objetivos deste trabalho foram identificar os sorovares de Salmonella isolados de carcaças de frango e caracterizá-los molecularmente por REP e ERIC-PCR, assim como identificar os fagotipos de Salmonella Enteriditis. Dos 25 isolados de Salmonella spp. analisados, 18 foram identificados como Enteriditis, 4 como Braenderup, 2 como Worthington e 1 como infantis. Dos 18 isolados de Enteriditis, 14 foram PT4, 2 PT4a, 1 PT7 e 1 RDNC, por se tratar de colônia rugosa. REP-PCR forneceu padrão eletroforético distinto de 10 a 13 bandas distribuídas entre 120 e 2072 pb para cada sorovar diferente testado. A ERIC-PCR mostrou um padrão de 4 a 5 bandas entre 180 e 1000 pb e foi menos discriminativa quando comparada à REP-PCR. Os resultados encontrados confirmaram que a fagotipagem é uma ferramenta útil e discriminativa para o sorovar Enteriditis. Apesar do pequeno número de sorovares testados, os resultados sugerem que a REP-PCR parece ser um método atrativo a ser utilizado no futuro para a discriminação preliminar de sorovares de Salmonella.

Detection and quantification of Roundup Ready® soybean residues in sausage samples by conventional and real-time PCR

The increasing presence of products derived from genetically modified (GM) plants in human and animal diets has led to the development of detection methods to distinguish biotechnology-derived foods from conventional ones. The conventional and real-time PCR have been used, respectively, to detect and quantify GM residues in highly processed foods. DNA extraction is a critical step during the analysis process. Some factors such as DNA degradation, matrix effects, and the presence of PCR inhibitors imply that a detection or quantification limit, established for a given method, is restricted to a matrix used during validation and cannot be projected to any other matrix outside the scope of the method. In Brazil, sausage samples were the main class of processed products in which Roundup Ready® (RR) soybean residues were detected. Thus, the validation of methodologies for the detection and quantification of those residues is absolutely necessary. Sausage samples were submitted to two different methods of DNA extraction: modified Wizard and the CTAB method. The yield and quality were compared for both methods. DNA samples were analyzed by conventional and real-time PCR for the detection and quantification of Roundup Ready® soybean in the samples. At least 200 ng of total sausage DNA was necessary for a reliable quantification. Reactions containing DNA amounts below this value led to large variations on the expected GM percentage value. In conventional PCR, the detection limit varied from 1.0 to 500 ng, depending on the GM soybean content in the sample. The precision, performance, and linearity were relatively high indicating that the method used for analysis was satisfactory.

Detection of enterotoxins produced by B. cereus through PCR analysis of ground and roasted coffee samples in Rio de Janeiro, Brazil

Coffee is one of the most appreciated drinks in the world. Coffee ground is obtained from the fruit of a small plant that belongs to the genus Coffea. Coffea arabica and Coffea canephora robusta are the two most commercially important species. They are more commonly known as arabica and robusta, respectively. Two-thirds of Coffea arabica plants are grown in South and Central America, and Eastern Africa - the place of origin for this coffee species. Contamination by microorganisms has been a major matter affecting coffee quality in Brazil, mainly due to the harvesting method adopted. Brazilian harvests are based on fruits collected from the ground mixed with those that fall on collection cloths. As the Bacillus cereus bacterium frequently uses the soil as its environmental reservoir, it is easily capable of becoming a contaminant. This study aimed to evaluate the contamination and potential of B. cereus enterotoxin genes encoding the HBL and NHE complexes, which were observed in strains of ground and roasted coffee samples sold in Rio de Janeiro. The PCR (Polymerase Chain Reaction) results revealed high potential of enterotoxin production in the samples. The method described by Speck (1984) was used for the isolation of contaminants. The investigation of the potential production of enterotoxins through isolates of the microorganism was performed using the B. cereus enterotoxin Reverse Passive Latex Agglutination test-kit (BCET-RPLA, Oxoid), according to the manufacturer's instructions. The potential of enterotoxin production was investigated using polymerase chain reaction (PCR) methods for hblA, hblD and hblC genes (encoding hemolysin HBL) and for nheA, nheB and nheC genes (encoding non-hemolytic enterotoxin - NHE). Of all the 17 strains, 100% were positive for at least 1 enterotoxin gene; 52.9% (9/17) were positive for the 3 genes encoding the HBL complex; 35.3% (6/17) were positive for the three NHE encoding genes; and 29.4% (5/17) were positive for all enterotoxic genes.

Standardization of a multiplex PCR for the identification of coagulase-positive Staphylococcus

The enterotoxigenic species Staphylococcus aureus, S. hyicus and S. intermedius show very similar characteristics, making their identification through conventional microbiological methods difficult. This study aimed at the development of a Multiplex PCR (mPCR) for the identification of S. aureus, S. intermedius and S. hyicus using the nuc gene as the target sequence. The results obtained suggest that the set of primers used was specific for the three species of Staphylococcus evaluate with a detection limit of 10² CFU.mL-1.

Characterization of spoilage bacteria in pork sausage by PCR-DGGE analysis

To investigate microbial diversity and identify spoilage bacteria in fresh pork sausages during storage, twelve industrial pork sausages of different trademarks were stored at 4 ºC for 0, 14, 28 and 42 days, 80% relative humidity and packaged in sterile plastic bags. Microbiological analysis was performed. The pH and water activity (a w) were measured. The culture-independent method performed was the Polymerase Chain Reaction - Denaturing Gradient Gel Electrophoresis (PCR-DGGE). The culture-dependent method showed that the populations of mesophilic bacteria and Lactic Acid Bacteria (LAB) increased linearly over storage time. At the end of the storage time, the average population of microorganisms was detected, in general, at the level of 5 log cfu g-1. A significant (P < 0.005) increase was observed in pH and a w values at the end of the storage time. The PCR-DGGE allowed a rapid identification of dominant communities present in sausages. PCR-DGGE discriminated 15 species and seven genera of bacteria that frequently constitute the microbiota in sausage products. The most frequent spoilage bacteria identified in the sausages were Lactobacillus sakei and Brochothrix thermosphacta. The identification of dominant communities present in fresh pork sausages can help in the choice of the most effective preservation method for extending the product shelf-life.

Ordered probit regression analysis of the effect of brand name on beer acceptance by consumers

Ordered probit regression was used to analyze data of sensory acceptance tests designed to study the effect of brand name on the acceptability of beer samples. Eight different brands of Pilsen beer were evaluated by 101 consumers in two sessions of acceptance tests: blind evaluation and brand information test. Ordered probit regression, although a relatively sophisticated technique compared to others used to analyze sensory data, was chosen to enable the observation of consumers' behavior using graphical interpretations of estimated probabilities plotted against hedonic scales. It can be concluded that brands B, C, and D had a positive effect on the sensory acceptance of the product, whereas brands A, F, G, and H had a negative influence on consumers' evaluation of the samples. On the other hand, brand E had little influence on consumers' assessment.

Extraction of DNA from honey and its amplification by PCR for botanical identification

The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

Multivariate study and regression analysis of gluten-free granola

This study developed a gluten-free granola and evaluated it during storage with the application of multivariate and regression analysis of the sensory and instrumental parameters. The physicochemical, sensory, and nutritional characteristics of a product containing quinoa, amaranth and linseed were evaluated. The crude protein and lipid contents ranged from 97.49 and 122.72 g kg-1 of food, respectively. The polyunsaturated/saturated, and n-6:n-3 fatty acid ratios ranged from 2.82 and 2.59:1, respectively. Granola had the best alpha-linolenic acid content, nutritional indices in the lipid fraction, and mineral content. There were good hygienic and sanitary conditions during storage; probably due to the low water activity of the formulation, which contributed to inhibit microbial growth. The sensory attributes ranged from 'like very much' to 'like slightly', and the regression models were highly fitted and correlated during the storage period. A reduction in the sensory attribute levels and in the product physical stabilisation was verified by principal component analysis. The use of the affective test acceptance and instrumental analysis combined with statistical methods allowed us to obtain promising results about the characteristics of gluten-free granola.

The association of markers of oxidative-inflammatory status with malnutrition in hemodialysis patients with serum ferritin lower than 500 ng/mL

INTRODUCTION: Enhanced inflammatory-oxidative status is well established in chronic kidney disease. OBJECTIVE: The objective of this study was to evaluate the oxidative- inflammatory status and iron indices in patients undergoing maintenance hemodialysis (HD) with serum ferritin lower than 500ng/mL, and to correlate them with nutritional status. METHOD: In a cross-sectional survey 35 HD patients (23 with normal nutritional status, 12 with Protein-Energy-Wasting syndrome, PEW), and healthy volunteers (n = 35) were studied. Serum concentration of iron, ferritin, transferrin saturation, malondialdehyde (MDA), protein carbonyl (PC), high-sensitive serum C -reactive protein (hs-CRP) and blood counts were determined. The nutritional status was determined by anthropometric and biochemical criteria. RESULTS: HD patients showed low values of hemoglobin and higher values of ferritin, MDA and PC when compared with healthy volunteers. HD subjects with PEW had higher values of PC and hs-PCR as compared to HD patients with normal nutritional status. A multiple logistic regression analysis showed that the independent variables PC (Wald Statistic 4.25, p = 0.039) and hs-CRP (Wald Statistic 4.83, p = 0.028) where related with the patients' nutritional condition. CONCLUSION: In HD patients with serum ferritin below 500 ng/mL was observed one association of the markers of oxidative stress and inflammation with poor nutritional status independently of serum ferritin, gender and age.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Sensibility of the PCR technique in the detection of Stenocarpella sp. associated with maize seeds

Maize seeds, infected by Stenocarpella species, are important sources of inoculum for the introduction and dissemination of stalk and ear rot and macrospore leaf spot diseases. The use of healthy seeds is an important strategy for the preventive control of these diseases. However, one of the difficulties in the health quality control programs for maize seeds is the availability of a reliable and quick method for detecting these fungi during routine seed analyses. Therefore, the objective of the present study was to investigate the possibility of using the PCR technique as an alternative method for accurately detecting these pathogens in maize seed samples. Maize seeds were kept in contact with S. maydis colonie developed in PDA media containing mannitol at -1.4 MPa for 72 h. The seed samples used in this study were prepared with infected seeds at incidences of 100, 20, 10, 2, 1 and zero %.The primers used were able to detect S. maydis fungi in association with seeds with a maximum of 2% , however those primers were not able to differentiate between the two species.

Aikaerotteisesti fluoresenssia mittaavan reaaliaikaisen PCR-laitteen kehitys

Kvantitatiivinen reaaliaikainen polymeraasiketjureaktio (engl. polymerase chain reaction, PCR) on osoittautunut käyttäjäystävällisimmäksi menetelmäksi nukleiinihapposekvenssien kvantitoimisessa. Tätä menetelmää voidaan herkistää pienempien DNA-pitoisuuksien havaitsemiseen käyttämällä hyväksi aikaerotteista fluorometriaa (engl. time-resolved fluorometry, TRF) ja luminoivia lantanidileimoja, joiden fluoresenssin pitkän eliniän ansiosta emission mittaus voidaan suorittaa vasta hetki virittävän valopulssin jälkeen, jolloin lyhytikäinen taustasäteily ehtii sammua. Tuloksena saadaan korkea signaali-taustasuhde. Tämän diplomityön tarkoituksena oli rakentaa TRF:än pystyvä reaaliaikainen PCR-laite, sillä tällaista laitetta ei ole markkinoilla tarjolla. Laite rakennettiin kehittämällä lämpökierrätin ja yhdistämällä se valmiiseen TRF:än kykenevään mittapäähän. Mittapään ja lämpökierrättimen hallitsemiseksi kehitettiin myös tietokoneohjelma. Valon tuottamiseksi ja mittaamiseksi haluttiin käyttää edullisia komponentteja, joten työssä käytettiin valmiin mittapään optiikkaa, jossa viritys tapahtuu hohtodiodilla (engl. light-emitting diode, LED) ja lantanidileiman emission mittaus fotodiodilla (engl. photodiode, PD) tai valomonistinputkella (engl. photomultiplier tube, PMT). Myös mittapään suorituskykyä tutkittiin. Työtä varten kehitettiin lämpökierrätin, joka koostui Peltier-elementillä lämmitettävästä PCR-putkitelineestä ja lämpökannesta. Mittalaitteen suorituskyvyn tutkimiseen käytettiin kelaattikomplementaatioon perustuvaa PCR-tuotteen havaitsemismenetelmää. Kelaattikomplementaatio perustuu kahteen erilliseen oligonukleotidimolekyyliin, joista toiseen on sidottu lantanidi-ioni ja toiseen valoa absorboiva ligandirakenne, jotka yhdessä muodostavat fluoresoivan kokonaisuuden. Kehitetyn lämpökierrättimen todettiin olevan tarpeeksi tarkka sekä tehokas ja sen lämmitys- ja jäähdytysnopeuden maksimeiksi saatiin 2,6 °C/sekunti. Detektorina käytetyn PD:n ei todettu olevan tarpeeksi herkkä emission havainnoimiseksi ja se korvattiin laitteessa PMT:llä. Käytetyllä PCR-määrityksellä kynnyssykleiksi (engl. threshold cycle, Ct) sekä kehitetylle että referenssilaitteelle saatiin 28,4 käyttämällä samaa 100 000 kopion DNA:n aloitusmäärää. Työssä osoitettiin, että on mahdollista kehittää edullisia komponentteja käyttävä, TRF:än pystyvä, reaaliaikainen PCR-laite, joka kykenee vastaavaan Ct-arvoon kuin vertailulaite. PD:n herkkyys ei kuitenkaan riittänyt. Tulokset olivat lupaavia, sillä LED- ja PD-teknologiat kehittyvät ja markkinoille on tullut myös muita komponentteja, joiden avulla on tulevaisuudessa mahdollista kehittää vielä herkempi laite.