913 resultados para Logics and Meanings of Programs


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Our previous study showed that electroacupuncture (EA) increases the concentration and reorganisation of collagen in a rat model of tendon healing. However, the ultrastructure of collagen fibrils after acupuncture is unknown. To assess the effect of acupuncture protocols on the ultrastructure of collagen fibrils during tendon healing. Sixty-four rats were divided into the following groups: non-tenotomised (normal group), tenotomised (teno group), tenotomised and subjected to manual acupuncture at ST36 (ST36 group), BL57 (BL57 group) and ST36+BL57 (SB group) and EA at ST36+BL57 (EA group). The mass-average diameter (MAD) and the reorganisation of collagen fibril diameters were determined during the three phases of tendon healing (at 7, 14 and 21 days). The MAD increased during the three phases of healing in the SB group. In the EA group, MAD increased initially but was reduced at day 21. The reorganisation of collagen fibrils was improved in the EA and SB groups at days 14 and 21, respectively. EA at day 21 appeared to reduce the reorganisation. These results indicate that the use of EA up to day 14 and manual acupuncture at ST36+BL57 up to day 21 improve the ultrastructure of collagen fibrils, indicating strengthening of the tendon structure. These data suggest a potential role for acupuncture in rehabilitation protocols.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The cranial base, composed of the midline and lateral basicranium, is a structurally important region of the skull associated with several key traits, which has been extensively studied in anthropology and primatology. In particular, most studies have focused on the association between midline cranial base flexion and relative brain size, or encephalization. However, variation in lateral basicranial morphology has been studied less thoroughly. Platyrrhines are a group of primates that experienced a major evolutionary radiation accompanied by extensive morphological diversification in Central and South America over a large temporal scale. Previous studies have also suggested that they underwent several evolutionarily independent processes of encephalization. Given these characteristics, platyrrhines present an excellent opportunity to study, on a large phylogenetic scale, the morphological correlates of primate diversification in brain size. In this study we explore the pattern of variation in basicranial morphology and its relationship with phylogenetic branching and with encephalization in platyrrhines. We quantify variation in the 3D shape of the midline and lateral basicranium and endocranial volumes in a large sample of platyrrhine species, employing high-resolution CT-scans and geometric morphometric techniques. We investigate the relationship between basicranial shape and encephalization using phylogenetic regression methods and calculate a measure of phylogenetic signal in the datasets. The results showed that phylogenetic structure is the most important dimension for understanding platyrrhine cranial base diversification; only Aotus species do not show concordance with our molecular phylogeny. Encephalization was only correlated with midline basicranial flexion, and species that exhibit convergence in their relative brain size do not display convergence in lateral basicranial shape. The evolution of basicranial variation in primates is probably more complex than previously believed, and understanding it will require further studies exploring the complex interactions between encephalization, brain shape, cranial base morphology, and ecological dimensions acting along the species divergence process.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Sunlight exposure causes several types of injury to humans, especially on the skin; among the most common harmful effects due to ultraviolet (UV) exposure are erythema, pigmentation and lesions in DNA, which may lead to cancer. These long-term effects are minimized with the use of sunscreens, a class of cosmetic products that contains UV filters as the main component in the formulation; such molecules can absorb, reflect or diffuse UV rays, and can be used alone or as a combination to broaden the protection on different wavelengths. Currently, worldwide regulatory agencies define which ingredients and what quantities must be used in each country, and enforce companies to conduct tests that confirm the Sun Protection Factor (SPF) and the UVA (Ultraviolet A) factor. Standard SPF determination tests are currently conducted in vivo, using human subjects. In an industrial mindset, apart from economic and ethical reasons, the introduction of an in vitro method emerges as an interesting alternative by reducing risks associated to UV exposure on tests, as well as providing assertive analytical results. The present work aims to describe a novel methodology for SPF determination directly from sunscreen formulations using the previously described cosmetomics platform and mass spectrometry as the analytical methods of choice.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Ofloxacin is an antimicrobial agent frequently found in significant concentrations in wastewater and surface water. Its continuous introduction into the environment is a potential risk to non-target organisms or to human health. In this study, ofloxacin degradation by UV/TiO2 and UV/TiO2/H2O2, antimicrobial activity (E. coli) of samples subjected to these processes, and by-products formed were evaluated. For UV/TiO2, the degradation efficiency was 89.3% in 60 min of reaction when 128 mg L(-1) TiO2 were used. The addition of 1.68 mmol L(-1) hydrogen peroxide increased degradation to 97.8%. For UV/TiO2, increasing the catalyst concentration from 4 to 128 mg L(-1) led to an increase in degradation efficiency. For both processes, the antimicrobial activity was considerably reduced throughout the reaction time. The structures of two by-products are presented: m/z 291 (9-fluoro-3-methyl-10-(methyleneamino)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid) and m/z 157 ((Z)-2-formyl-3-((2-oxoethyl)imino)propanoic acid).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The purpose of this study was to correlate the pre-operative imaging, vascularity of the proximal pole, and histology of the proximal pole bone of established scaphoid fracture non-union. This was a prospective non-controlled experimental study. Patients were evaluated pre-operatively for necrosis of the proximal scaphoid fragment by radiography, computed tomography (CT) and magnetic resonance imaging (MRI). Vascular status of the proximal scaphoid was determined intra-operatively, demonstrating the presence or absence of puncate bone bleeding. Samples were harvested from the proximal scaphoid fragment and sent for pathological examination. We determined the association between the imaging and intra-operative examination and histological findings. We evaluated 19 male patients diagnosed with scaphoid nonunion. CT evaluation showed no correlation to scaphoid proximal fragment necrosis. MRI showed marked low signal intensity on T1-weighted images that confirmed the histological diagnosis of necrosis in the proximal scaphoid fragment in all patients. Intra-operative assessment showed that 90% of bones had absence of intra-operative puncate bone bleeding, which was confirmed necrosis by microscopic examination. In scaphoid nonunion MRI images with marked low signal intensity on T1-weighted images and the absence of intra-operative puncate bone bleeding are strong indicatives of osteonecrosis of the proximal fragment.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Efforts presented by the scientific community in recent years towards the development of numerous green chemical processes and wastewater treatment technologies are presented and discussed. In the light of these approaches, environmentally friendly technologies, as well as the key role played by the well-known advanced oxidation processes, are discussed, giving special attention to the ones comprising ozone applications. Fundamentals and applied aspects dealing with ozone technology and its application are also presented.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Disorders of sex development (DSD) involve several conditions that result from abnormalities during gonadal determination and differentiation. Some of these disorders may manifest at birth by ambiguous genitalia; others are diagnosed only at puberty, by the delayed onset of secondary sexual characteristics. Sex determination and differentiation in humans are processes that involve the interaction of several genes such as WT1, NR5A1, NR0B1, SOX9, among others, in the testicular pathway, and WNT4, DAX1, FOXL2 and RSPO1, in the ovarian pathway. One of the major proteins in mammalian gonadal differentiation is the steroidogenic nuclear receptor factor 1 (SF1). This review will cover some of the most recent data on SF1 functional roles and findings related to mutations in its coding gene, NR5A1.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

PURPOSE: To evaluate the sensitivity and specificity of machine learning classifiers (MLCs) for glaucoma diagnosis using Spectral Domain OCT (SD-OCT) and standard automated perimetry (SAP). METHODS: Observational cross-sectional study. Sixty two glaucoma patients and 48 healthy individuals were included. All patients underwent a complete ophthalmologic examination, achromatic standard automated perimetry (SAP) and retinal nerve fiber layer (RNFL) imaging with SD-OCT (Cirrus HD-OCT; Carl Zeiss Meditec Inc., Dublin, California). Receiver operating characteristic (ROC) curves were obtained for all SD-OCT parameters and global indices of SAP. Subsequently, the following MLCs were tested using parameters from the SD-OCT and SAP: Bagging (BAG), Naive-Bayes (NB), Multilayer Perceptron (MLP), Radial Basis Function (RBF), Random Forest (RAN), Ensemble Selection (ENS), Classification Tree (CTREE), Ada Boost M1(ADA),Support Vector Machine Linear (SVML) and Support Vector Machine Gaussian (SVMG). Areas under the receiver operating characteristic curves (aROC) obtained for isolated SAP and OCT parameters were compared with MLCs using OCT+SAP data. RESULTS: Combining OCT and SAP data, MLCs' aROCs varied from 0.777(CTREE) to 0.946 (RAN).The best OCT+SAP aROC obtained with RAN (0.946) was significantly larger the best single OCT parameter (p<0.05), but was not significantly different from the aROC obtained with the best single SAP parameter (p=0.19). CONCLUSION: Machine learning classifiers trained on OCT and SAP data can successfully discriminate between healthy and glaucomatous eyes. The combination of OCT and SAP measurements improved the diagnostic accuracy compared with OCT data alone.