Fundações de construções submetidas a esforços de tração em solo de alta porosidade da região de Campinas - SP

This paper presents the behavior of three bored piles conducted in diabasic soil submitted to uplift forces. The piles were built at the site for Experimental Studies in Soil Mechanics and Foundations of UNICAMP, located in the city of Campinas, Brazil. Field tests have already been conducted at the site (SPT, CPT, DMT and PMT), as well as laboratory tests by using sample soils taken from a well up to 17 m deep. The water table is not checked until a depth of 17 m. In order to check the behavior of the piles when submitted to uplift forces, slow static load tests were carried out as the recommendations of NBR 12131. The carrying capacity of these piles was also provided by means of theoretical methods, appropriate for uplift forces, and through semi-empirical methods appropriate for compression forces, considering only the portion of lateral resistance. The values estimated by using the considered methods were compared to those obtained by means of load tests. One of the tested piles was extracted from the soil to be the subject of a study on its geometry.

Germinação de Ternstroemia brasiliensis Cambess. (Pentaphylacaceae) de floresta de restinga

The main purpose of this work was to study the germination of Ternstroemia brasiliensis seeds both in laboratory and field conditions in order to contribute to understanding the regeneration ecology of the species. The seeds were dispersed with relatively high moisture content and exhibit a recalcitrant storage behaviour because of their sensitivity to dehydration and to dry storage. The germinability is relatively high and is not affected either by light or aril presence. The absence of the dormancy and the low sensitivity to far red light can enable to seeds to promptly germinate under Restinga forest canopy, not forming a soil seed bank. The constant temperatures of 25 ºC and 30 ºC were considered optimum for germination of T. brasiliensis seeds. Temperature germination parameters can be affected by light conditions. The thermal-time model can be a suitable tool for investigating the temperature dependence on the seed germination of T. brasiliensis. The germination characteristics de T. brasiliensis are typical of non pioneer species, and help to explain the distribution of the species. Germination of T. brasiliensis seeds in Restinga environment may be not limited by light and temperature; otherwise the soil moisture content can affect the seed germination.

Atributos mecânicos e erosão por salpicamento em amostras de latossolo vermelho-amarelo sob efeito de vinhaça

The objective of this study was to quantify the effect of plonk on compressive behavior and mechanical attributes such as consistency, optimum moisture for compaction and maximum density of a Red-Yellow Latosol (Oxisol) to evaluate the effect of plonk and compaction state in splashed particles, from Lavras (MG) region. The plonk was obtained from an artisanal sugarcane brandy alembic. Undisturbed and disturbed soil samples were collected at 0 to 3 cm and 60 to 63 cm depths. Disturbed soil samples were used for soil characterization, determination of consistence limits and Normal Proctor essay after material incubation with plonk. Undisturbed soil samples were saturated with plonk or distilled water (control) during 48 hours for testing the compressibility and resistance to splash by using simulated rainfall. The plonk altered the consistence limits of studied layers. For the 0-3 cm layer, the plonk reduced the friable range, and for the 60-63 cm layer the effect was in the opposite direction. For both layers, the plonk increased Dmax and decreased Uoptimum. Regardless of the plonk treatment, both layers presented the same load support capacity. The compaction degree of samples influenced the splash erosion. The increase of the applied pressure over the samples resulted in increase of splash material quantity. At the 60-63 cm layer, the plonk treatment reduced the splash material quantity by increasing the applied pressure, mainly when the samples were at field capacity.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Imigrantes bolivianos em São Paulo : a Praça Kantuta e o futebol

Universidade Estadual de Campinas . Faculdade de Educação Física

Praticas socioculturais, poder e diferenciação em Bico, Cuiamucu e Canela-Fina - comunidades amazonicas

Universidade Estadual de Campinas . Faculdade de Educação Física

Effect of silicate fertilization on soil and on palisade grass plants under grazing intensities

Application of calcium silicate (SiCa) as soil acidity corrective was evaluated in a Rhodic Hapludox soil with palisade grass conducted under pasture rotation system with different grazing intensities. Experimental design was complete randomized blocks with four grazing intensities - grazing intensities were imposed by forage supply (50, 100, 150 and 200 kg t-1 of DM per LW) - in experimental plots with four replicates and, in the subplots, with seven doses of calcium silicate combined with lime: 0+0, 2+0, 4+0, 6+0, 2+4, 4+2 and 0+6 t ha-1, respectively. In the soil, it was evaluated the effect of four levels of calcium silicate (0, 2, 4 and 6 t ha-1) at 45, 90, and 365 days at three depths (0-10, 10-20 and 20-40 cm) and at 365 days, it was included one level of lime (6 t ha-1). For determination of leaf chemical composition and silicate content in the soil, four levels of calcium silicate (0, 2, 4 and 6 t ha-1) were evaluated at 45 and 365 days and at 45 days only for leaf silicate, whereas for dry matter production, all corrective treatments applied were evaluated in evaluation seasons. Application of calcium silicate was positive for soil chemical traits related to acidity correction (pH(CaCl2), Ca, Mg, K, H+Al and V), but the limestone promoted better results at 365 days. Leaf mineral contents were not influenced by application of calcium silicate, but there was an increase on silicate contents in leaves and in the soil. Dry matter yield and chemical composition of palisade grass improved with the application of correctives.

New methods to quantify NH3 volatilization from fertilized surface soil with urea

Gaseous N losses from soil are considerable, resulting mostly from ammonia volatilization linked to agricultural activities such as pasture fertilization. The use of simple and accessible measurement methods of such losses is fundamental in the evaluation of the N cycle in agricultural systems. The purpose of this study was to evaluate quantification methods of NH3 volatilization from fertilized surface soil with urea, with minimal influence on the volatilization processes. The greenhouse experiment was arranged in a completely randomized design with 13 treatments and five replications, with the following treatments: (1) Polyurethane foam (density 20 kg m-3) with phosphoric acid solution absorber (foam absorber), installed 1, 5, 10 and 20 cm above the soil surface; (2) Paper filter with sulfuric acid solution absorber (paper absorber, 1, 5, 10 and 20 cm above the soil surface); (3) Sulfuric acid solution absorber (1, 5 and 10 cm above the soil surface); (4) Semi-open static collector; (5) 15N balance (control). The foam absorber placed 1 cm above the soil surface estimated the real daily rate of loss and accumulated loss of NH3N and proved efficient in capturing NH3 volatized from urea-treated soil. The estimates based on acid absorbers 1, 5 and 10 cm above the soil surface and paper absorbers 1 and 5 cm above the soil surface were only realistic for accumulated N-NH3 losses. Foam absorbers can be indicated to quantify accumulated and daily rates of NH3 volatilization losses similarly to an open static chamber, making calibration equations or correction factors unnecessary.

Estimativas do teor de umidade empregando o método GPR: uma avaliação comparativa em experimentos de laboratório e campo

Este trabalho faz uma análise das estimativas de teores de umidade obtidas com o método Ground Penetrating Radar (GPR) comparativamente às determinadas com os métodos Time Domain Reflectometry (TDR) e gravimétrico. Os dados foram obtidos em dois experimentos diferentes: um experimento controlado em laboratório buscando reproduzir um meio homogêneo onde foram obtidas as medidas de umidade com GPR (antenas de 1 GHz) e TDR, e outro experimento de campo onde foram obtidos dados com GPR (antenas de 200 MHz) e de amostras de solos do local. Para a obtenção das estimativas a partir do método GPR foram analisados os eventos relativos à onda de transmissão direta entre as antenas, onda refratada criticamente e onda refletida em interfaces com diferentes propriedades elétricas.O GPR mostrou-se sensível às variações de umidades presentes nos dois experimentos e apresentou boa correlação com os dados obtidos com TDR (REQM de0,007 m³m-3) e das amostras (REQM de 0,039 m³m-3).

Influence of soil properties on the abundance of plant species in ferruginous rocky soils vegetation, southeastern Brazil

Ferruginous "campos rupestres" are a particular type of vegetation growing on iron-rich primary soils. We investigated the influence of soil properties on plant species abundance at two sites of ferruginous "campos rupestres" and one site of quartzitic "campo rupestre", all of them in "Quadrilátero Ferrífero", in Minas Gerais State, southeastern Brazil. In each site, 30 quadrats were sampled to assess plant species composition and abundance, and soil samples were taken to perform chemical and physical analyses. The analyzed soils are strongly acidic and presented low fertility and high levels of metallic cations; a principal component analysis of soil data showed a clear segregation among sites due mainly to fertility and heavy metals content, especially Cu, Zn, and Pb. The canonical correspondence analysis indicated a strong correlation between plant species abundance and soil properties, also segregating the sites.

Intertidal life: field observations on the clingfish Gobiesox barbatulus in southeastern Brazil

The clingfish Gobiesox barbatulus shows nocturnal feeding activity, spending most part of the day stationary and adhered to the inferior part of stones. To feed, this species uses the sit-and-wait and particulate feeding tactics. It shows a carnivorous feeding habit mostly consuming small benthic crustaceans. It can move in two ways: (1) "stone-by-stone", sliding its ventral sucker disc across each stone and (2) "surf", when it takes advantage of the energy of the ebbing tide to quickly cross a distance up to four times its body length. Its reproductive season occurs between the end of spring and the beginning of summer, during which time it lays about 2,000 adhesive eggs of 1 mm each in a single layer under stones. It has more than one egg-laying session per reproductive season, therefore showing several different developmental stages. It performs fanning, mouthing and guarding of the eggs as forms of parental care. Data shown here also indicates that G. barbatulus has some shelter fidelity, being probably territorial.

Mineralogical characterization of a highly-weathered soil by the Rietveld Method

The mineralogical characterization through mineral quantification of Brazilian soils by X-ray diffraction data using the Rietveld Method is not common. A mineralogical quantification of an Acric Ferralsol from the Ponta Grossa region, state of Paraná, Brazil, was carried out using this Method with X-Ray Diffraction data to verify if this method was suitable for mineral quantification of a highly-weathered soil. The A, AB and B3 horizons were fractioned to separate the different particle sizes: clay, silt, fine sand (by Stokes Law) and coarse sand fractions (by sieving), with the procedure free of chemical treatments. X-ray Fluorescence, Inductively Coupled Plasma Atomic Emission Spectrometry, Infrared Spectroscopy and Mössbauer Spectroscopy were used in order to assist the mineral identification and quantification. The Rietveld Method enabled the quantification of the present minerals. In a general way, the quantitative mineralogical characterization by the Rietveld Method revealed that quartz, gibbsite, rutile, hematite, goethite, kaolinite and halloysite were present in the clay and silt fractions of all horizons. The silt fractions of the deeper horizons were different from the more superficial ones due to the presence of large amounts of quartz. The fine and the coarse sand fractions are constituted mainly by quartz. Therefore, a mineralogical quantification of the finer fraction (clay and silt) by the Rietveld Method was successful.

Lessons from the Terra Preta de Índios of the Amazon region for the utilisation of charcoal for soil amendment

The potential of charcoal and of partially combusted organic waste to mimic the soil organic matter of the Terras Pretas de Índios (Amazonian Dark Earths) from the Amazon Region is discussed. These materials serve as soil conditioners and as sequesterers of carbon in recalcitrant and in reactive forms. Studies carried out by Brazilian and by international groups have contributed to the emergence of an awareness of the compositions and of the uses of these materials. In this contribution we report on chemical studies that are leading to the development of a scientific and technological awareness, and of innovations that will have value in finding novel uses in applications to soil of chars from organic wastes such as those from the biofuel industry, and from metallurgical and various coal plant residues.

Multivariate analysis of the effects of soil parameters and environmental factors on the flavonoid content of leaves of Passiflora incarnata L., Passifloraceae

The aim of the present study was to evaluate the effect of soil characteristics (pH, macro- and micro-nutrients), environmental factors (temperature, humidity, period of the year and time of day of collection) and meteorological conditions (rain, sun, cloud and cloud/rain) on the flavonoid content of leaves of Passiflora incarnata L., Passifloraceae. The total flavonoid contents of leaf samples harvested from plants cultivated or collected under different conditions were quantified by high-performance liquid chromatography with ultraviolet detection (HPLC-UV/PAD). Chemometric treatment of the data by principal component (PCA) and hierarchic cluster analyses (HCA) showed that the samples did not present a specific classification in relation to the environmental and soil variables studied, and that the environmental variables were not significant in describing the data set. However, the levels of the elements Fe, B and Cu present in the soil showed an inverse correlation with the total flavonoid contents of the leaves of P. incarnata.

Comparison of full-field electroretinogram in diabetic and non diabetic dogs with cataracts

Being the commonest ocular disorder, dense cataracts disable fundoscopic examination and the diagnosis of retinal disorders, which dogs may be predisposed. The aim of this study was to compare the electroretinographic responses recorded according to the International Society for Clinical Electrophysiology of Vision human protocol to evaluate retinal function of diabetic and non diabetic dogs, both presenting mature or hypermature cataracts. Full-field electroretinogram was recorded from 66 dogs, with ages varying from 6 to 15 years old allocated into two groups: (1) CG, non diabetic cataractous dogs, and (2) DG, diabetic cataractous dogs. Mean peak-to-peak amplitude (microvolts) and b-wave implicit time (milliseconds) were determined for each of the five standard full-field ERG responses (rod response, maximal response, oscillatory potentials, single-flash cone response and 30 Hz flicker). Comparing CG to DG, ERGs recorded from diabetic dogs presented lower amplitude and prolonged b-wave implicit time in all ERG responses. Prolonged b-wave implicit time was statistically significant (p< 0.05) at 30 Hz flicker (24.0 ms versus 22.4 ms). These data suggests full-field ERG is capable to record sensible alterations, such as flicker's implicit time, being useful to investigate retinal dysfunction in diabetic dogs.