793 resultados para Sporting Events


Relevância:

60.00% 60.00%

Publicador:

Resumo:

In a communication to the Parliament and the Council entitled “Towards a modern, more European copyright framework” and dated 9 December 2015,1 the European Commission confirmed its intention to progressively remove the main obstacles to the functioning of the Digital Single Market for copyrighted works. The first step of this long-term plan, which was first announced in Juncker’s Political Guidelines2 and the Communication on “A Digital Single Market strategy for Europe”,3 is a proposal for a regulation aimed at ensuring the so-called ‘cross-border portability’ of online services giving access to content such as music, games, films and sporting events.4 In a nutshell, the proposed regulation seeks to enable consumers with legal access to such online content services in their country of residence to use the same services also when they are in another member state for a limited period of time. On the one hand, this legislative proposal has the full potential to resolve the (limited) issue of portability, which stems from the national dimension of copyright and the persisting territorial licensing and distribution of copyright content.5 On the other hand, as this commentary shows, the ambiguity of certain important provisions in the proposed regulation might affect its scope and effectiveness and contribute to the erosion of the principle of copyright territoriality.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Event Marketing represents a common promotional strategy that involves direct contact between brands and consumers at special events, namely concerts, festivals, sporting events and fairs. Brands have been investing in sponsorship as a means of associating themselves with particular events, essentially with the goal to enhance brand image and brand awareness. Interestingly, the response of consumers to event marketing has not yet been fully understood. This dissertation fills this gap. More specifically, it intends to determine the extent to which sponsoring brands at events favors brand awareness (recall and recognition) and how it relates to brand attitude. Based on three Portuguese music festivals, two studies were conducted to ascertain event sponsorship’s impact on consumer memory, notably Brand Recall and Brand Recognition, and correlation with attitudes towards the brands such as familiarity and liking. The key findings of these studies show that recognition is much higher for those respondents who attended the festivals, presenting a score of 73,9%, in comparison with recall, presenting a much lower score of 37,5%. Further, and surprisingly, it suggests that the ability to recall and recognize sponsoring brands is not associated to consumer attitudes towards the brands. Instead, it relates to the time consumers dedicated to these particular events, that is, the number of music festivals attended.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Background The tobacco industry has long sought affiliation with major sporting events, including the Olympic Games, for marketing, advertising and promotion purposes. Since 1988, each Olympic Games has adopted a tobacco-free policy. Limited study of the effectiveness of the smoke-free policy has been undertaken to date, with none examining the tobacco industry's involvement with the Olympics or use of the Olympic brand. Methods and Findings A comparison of the contents of Olympic tobacco-free policies from 1988 to 2014 was carried out by searching the websites of the IOC and host NOCs. The specific tobacco control measures adopted for each Games were compiled and compared with measures recommended by the WHO Tobacco Free Sports Initiative and Article 13 of the Framework Convention on Tobacco Control (FCTC). This was supported by semi-structured interviews of key informants involved with the adoption of tobacco-free policies for selected games. To understand the industry's interests in the Olympics, the Legacy Tobacco Documents Library (http://legacy.library.ucsf.edu) was systematically searched between June 2013 and August 2014. Company websites, secondary sources and media reports were also searched to triangulate the above data sources. This paper finds that, while most direct associations between tobacco and the Olympics have been prohibited since 1988, a variety of indirect associations undermine the Olympic tobacco-free policy. This is due to variation in the scope of tobacco-free policies, limited jurisdiction and continued efforts by the industry to be associated with Olympic ideals. Conclusions The paper concludes that, compatible with the IOC's commitment to promoting healthy lifestyles, a comprehensive tobacco-free policy with standardized and binding measures should be adopted by the International Olympic Committee and all national Olympic committees.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Flertalet evenemang är idag beroende av funktionärer för att genomföras. Att ha funktionärer till hjälp är ekonomiskt bärkraftigt för organisationer som anordnar evenemang, då de inte behöver anställa betald personal. Vetenskapliga studier menar att organisationer bör upprätta tydliga planer eller strategier för hur de ska hantera funktionärer då konkurrensen om funktionärerna ökar. Eftersom det är kostsamt att rekrytera nya funktionärer bör det vara av stor vikt för organisationer att försöka behålla sina funktionärer inför framtiden. Syftet är att undersöka organisationer som arrangerar årligen återkommande idrottsevenemang för att få en djupare förståelse för hur de arbetar med sina funktionärer. För att undersöka detta har vi intervjuat tre av Sveriges största årligen återkommande idrottsevenemang som alla är beroende av funktionärer. Intervjuerna genomfördes personligen med respektive person i organisationen som hade det övergripande ansvaret för funktionärer. Undersökningen visar att väletablerade evenemang, som de i studien, har vissa likheter i hur de hanterar funktionärer som vetenskapliga studier förespråkar. Att följa en strikt plan för hur arbetet med funktionärer bör gå till visar sig inte vara nödvändigt. Det visade sig att samtliga organisationer delegerar ansvaret för funktionärer till projektledare eller huvudfunktionärer. Det som var viktigt vid rekryteringen var; synliggöra, intervjuer och utbildning. Det som utmärkte sig vid att försöka få funktionärerna att återkomma var; förmåner, kommunikation och relationen. Resultatet visade att arbetet med funktionärerna, trots att de kan vara många till antalet, inte behöver vara komplicerat.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

O contínuo crescimento do espaço particular aberto ao público contribuiu para o aparecimento e desenvolvimento da segurança privada, aumentando a sua comercialização e o seu número de efetivos. Apesar dos espetáculos desportivos serem eventos privados, a lei prevê, em certos casos, a obrigatoriedade da requisição de policiamento, por parte dos promotores. Será adequada a presença das Forças de Segurança para assegurar um evento particular ou será tarefa para a segurança privada? Tendo em conta a atualidade do assunto, torna-se uma mais-valia o estudo e compreensão do regime de policiamento de espetáculos desportivos, de forma a mitigar os seus aspetos negativos. Assim sendo, o presente trabalho tem como objetivo geral compreender de que forma o atual regime de policiamento se encontra adequado às exigências dos espetáculos desportivos. Para melhor orientar a investigação, foram definidos objetivos específicos, designadamente identificar as potencialidades do atual regime de policiamento na segurança dos espetáculos desportivos, identificar as vulnerabilidades do atual regime de policiamento na segurança dos espetáculos desportivos e compreender de que forma se podem mitigar as consequências negativas deste regime de policiamento na segurança dos espetáculos desportivos. A base lógica da presente investigação é o método dedutivo. Não temos como finalidade propor um novo regime de policiamento de espetáculos desportivos, mas sim analisar o regime já existente. Por conseguinte, a presente investigação desenvolveu-se através das seguintes fases: exploratória, analítica e conclusiva. De forma a sustentar as nossas conclusões, procedemos à análise documental, realização de entrevistas, observações qualitativas e, por último, à análise qualitativa do seu conteúdo. No decorrer da investigação, verificámos a existência de uma cultura de segurança que dificulta, à segurança privada, assumir a exclusividade da segurança dum evento desportivo. Nestas situações, a presença das Forças de Segurança é essencial, sendo ainda mais notória nos eventos desportivos realizados na via pública, onde a principal missão é garantir a segurança dos atletas e assegurar a fluidez e segurança do tráfego rodoviário. Não obstante, foi possível identificar algumas vulnerabilidades no presente regime de policiamento, pelo que propusemos um conjunto de medidas que podem ser implementadas, nomeadamente a gradual adaptação ao modelo de policiamento praticado no Reino Unido. Para tal, seria necessário aumentar o número de Assistentes de Recinto Desportivo, investindo mais na sua formação e atribuindo-lhes mais competências, contribuindo para a sua autoridade na presença dos adeptos.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

El orgullo brasileño estalló en el año 2007, cuando Brasil fue elegido sede del mundial FIFA 2014. Esto se debe a que Brasil en ese momento gozaba de un creciente prestigio internacional por cuenta de su condición de Potencia Emergente, miembro de los BRICS, aspirante a un puesto permanente en el Consejo de Seguridad y contar con la selección de fútbol más exitosa de la historia. No obstante, en su afán por incrementar su visibilidad y proyección internacional acudió al ejercicio del Poder Blando, a través de la Diplomacia Cultural, concretamente se decidió por la Organización de Mega Eventos deportivos, al tiempo que debía enfrentar varios problemas en el ámbito interno (desigualdad, corrupción, pobreza). Así, esta estrategia de aplicación del Poder Blando resultó de cierta manera contraproducente, debido a que la política exterior y su éxito no suele estar disociada de la realidad interna.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

We study market reaction to the announcements of the selected country hosting the Summer and Winter Olympic Games, the World Football Cup, the European Football Cup and World and Specialized Exhibitions. We generalize previous results analyzing a large number and different types of mega-events, evaluate the effects for winning and losing countries, investigate the determinants of the observed market reaction and control for the ex ante probability of a country being a successful bidder. Average abnormal returns measured at the announcement date and around the event are not significantly different from zero. Further, we find no evidence supporting that industries, that a priori were more likely to extract direct benefits from the event, observe positive significant effects. Yet, when we control for anticipation, the stock price reactions around the announcements are significant.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The past two centuries have witnessed the rise of nationalist movements and widespread nationalism. As these movements gained strength in Europe, sport played a role in their development. Media representations of sport recount events in a way that reinforces cultural values and this research investigates media representations of Croatian nationalism in the weeks surrounding the country’s third place victory in the 1998 FIFA World Cup. Sociological theories alongside more contemporary theories of sport and nation construction are considered. Croatian newspapers were analyzed for elements of national identity construction. The study concludes that the 1998 World Cup played an important role in Croatia’s on-going construction of nationhood and invention of nationalist traditions. This research further demonstrates sport’s ability to evoke strong emotions that are difficult to witness in other areas of social life and the direct role of sport in garnering nationalism.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This volume explores sports mega-events, their social, political, and cultural characters, the value systems that they inscribe and draw on, the claims they make on us and the claims the organisers make for them, the spatial and ethical relationships they create, and the responses of civil societies to them. Our premise is that sports mega-events are not simply sporting or cultural phenomena. They are also political and economic events, characterised by the generation and projection of symbolic meanings – most obviously over the nature of statehood, economic power, and of collective cultural identity – and by social conflict, especially over land use, and over the extent and contours of public spending commitments. Because of their peculiar spatial and temporal organization, they raise questions about the relationships between global cultural and economic flows and particular local and national spaces. Because of their evolutionary characteristics, they ask us to consider not simply the time of the event but of the effects of the event on the long-term direction, implementation, and consequences of public policy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física