Phlebotomines (Diptera, Psychodidae) in the Ribeira Valley Speleological Province - 1. Parque Estadual Intervales, state of São Paulo, Brazil

The identification of the sandfly fauna and investigation of some ecological aspects of its populations in areas frequented by tourists of the PEI, an Atlantic forest reserve with many caves, were the objective of this study. Captures were undertaken monthly from January 2001 to December 2002, with automatic light traps installed in 13 ecotopes, including caves, forests, domiciliary and peridomiciliary environments, and by aspiration in armadillo burrows. Additionally, although not at regular intervals, Shannon traps were installed in forests and anthropic environments, aspirations were made on cave walls, among roots and fallen leaves, and some insects were captured while biting researchers. A total of 891 sandflies belonging to 21 species were captured. Six hundred specimens representing 19 species were captured with light traps, 215 in anthropic (2.24 insects/trap) and 385 in extra-domiciliary (1.46 insects/trap) environments. Brumptomyia troglodytes was the most abundant species (the Standardised Index of Species Abundance = 0.705). Pintomyia monticola predominated in the Shannon traps and showed anthropophilic and diurnal activity. Psathyromyia pascalei predominated in the aspirations; the largest number being in armadillo burrows. Eleven species were captured in caves; although some might be troglophiles, the majority used these ecotopes as resting places. Nyssomyia intermedia, Nyssomyia neivai and Migonemyia migonei, implicated in the transmission of cutaneous leishmaniasis in the Southeastern Brazilian region, were all found, though in such low densities as to suggest minimal risk of the disease in the PEI.

Phlebotomines (Diptera, Psychodidae) in the Speleological Province of the Ribeira Valley: 2. Parque Estadual do Alto Ribeira (PETAR), São Paulo State, Brazil

The Parque Estadual do Alto Ribeira (PETAR) with about 250 caves, in an Atlantic forest reserve, is an important ecotourist attraction in the Ribeira Valley, an endemic area of American cutaneous leishmaniasis (ACL). With the purpose of investigating Leishmania vector species bothersome to humans the sandfly fauna was identified and some of its ecological aspects in the Santana nucleus, captures were undertaken monthly with automatic light traps in 11 ecotopes, including caves, forests, a camping site and domiciliary environments, and on black and white Shannon traps, from January/2001 to December/2002. A total of 2,449 sandflies representing 21 species were captured. The highest values of abundance obtained in the captures with automatic light traps were for Psathyromyia pascalei and Psychodopygus ayrozai. A total of 107 specimens representing 13 species were captured on black (12 species) and white (6 species) Shannon traps set simultaneously. Psychodopygus geniculatus females predominated on the black (43.75%), and Psathyromyia lanei and Ps. ayrozai equally (32.4%) on the white. Nyssomyia intermedia and Nyssomyia neivai, both implicated in the transmission of ACL in the Brazilian Southeastern region, were also captured. Ny. intermedia predominated in the open camping area. Low frequencies of phlebotomines were observed in the caves, where Evandromyia edwardsi predominated Lutzomyia longipalpis, the main vector of the American visceral leishmaniasis, was aslo present. This is its most southernly reported occurrence in the Atlantic forest.

Phlebotomines (Diptera, Psychodidae) in the Speleological Province of the Ribeira Valley: 3. Serra district - area of hostels for tourists who visit the Parque Estadual do Alto Ribeira (PETAR), state of São Paulo, Brazil

Phlebotomines (Diptera, Psychodidae) in the Speleological Province of the Ribeira Valley: 3. Area of hostels for tourists who visit the Parque Estadual do Alto Ribeira (PETAR), state of São Paulo, Brazil. The study characterizes some ecological aspects of the phlebotomine fauna in an endemic area of cutaneous leishmaniasis (CL) situated in the Serra district, Iporanga municipality where the hostels for tourists visiting the PETAR are located. Captures were undertaken on a smallholding and a small farm situated near the hostels, monthly between January/2001 and December/2003 with automatic light traps (ALT) in pigsty, hen-house and veranda of a domicile at the two sites, and in peridomicile of the small farm also with black/white Shannon traps. With the ALT a total of 87,224 phlebotomines representing 19 species and also two hybrids of Nyssomyia intermedia (Lutz & Neiva) and Nyssomyia neivai (Pinto) and two anomalous specimens were captured. The standardized index species abundance was for Ny. intermedia = 1.0 and Ny. neivai = 0.935. The highest frequencies of the smallholding occurred in the pigsty, the Williams' mean/capture for Ny. intermedia being 63.7 specimens and for Ny. neivai 29.2, and on the small farm, in the hen-house, Ny. intermedia 402.6 and Ny. neivai 116.2. A total of 863 phlebotomines (Ny. intermedia: 75.4%; Ny. neivai: 24.3%) were captured with black/white Shannon traps; females of both species being predominant in the white trap. The high frequencies of Ny. intermedia and Ny. neivai, both implicated in CL transmission, indicate the areas presenting risk of the disease.

Fauna of phlebotomine sand flies (Diptera, Psychodidae) in areas with endemic American cutaneous leishmaniasis in the State of Mato Grosso do Sul, Brazil

Fauna of phlebotomine sand flies (Diptera, Psychodidae) in areas with endemic American cutaneous leishmaniasis in the State of Mato Grosso do Sul, Brazil. The aim of this study was to investigate the ecological aspects of the main vectors of American cutaneous leishmaniasis (ACL) in four monitoring stations situated in the municipalities of Naviraí, Nova Andradina, Novo Horizonte do Sul and Rio Verde de Mato Grosso. For each monitoring station, the captures of sand flies were undertaken each month from July 2008 to June 2010 using CDC and Shannon traps. The CDC traps were installed simultaneously for three consecutive nights in three collection sites: intradomicile, peridomicile and edge of the forest. A Shannon trap was installed from dusk to 10 pm, inside the forest, one night per month. A total of 7,651 sand flies belonging to nine genera and twenty-nine species were captured. Nyssomyia neivai (52.95%), Psathyromyia hermanlenti (10.91%), Psathyromyia runoides (9.16%), Nyssomyia whitmani (7.95%), Psathyromyia aragaoi (4. 89%), Nyssomyia antunesi (3.14%) and Evandromyia bourrouli (2.20%) were the most frequent species. Approximately 65% of the sand flies were collected in the forest environment. The municipalities presented significantly different indexes of species diversity. Naviraí presented the lowest species diversity index, however, it showed the highest abundance. Novo Horizonte do Sul had the highest species diversity index, but the lowest abundance (< 5%). It is noteworthy the occurrence of vector species of Leishmania in the areas studied, especially in Naviraí, where Ny. neivai presented high frequencies which may explain the increased number of ACL cases in this municipality.

Phlebotomine (Diptera: Psychodidae) survey and some considerations about epidemiological aspects of canine leishmaniasis in Rio Claro city, São Paulo, Brazil.

Between 2000 and 2004, 170 sand flies were captured in urban or peri-urban areas of the Rio Claro city, SP, Brazil. Nyssomyia neivai, the main LTA vector species in São Paulo territory, corresponded to 124 specimens (72,94%) of the total number of captured insects. Incidence of American Cutaneous (LTA) and Visceral leishmaniasis (LVA) is increasing in human and dogs in São Paulo State. Rio Claro city is located in the center-east region of the State. During 2001 and 2003, two cases of alochtonus canine LVA and an autochthonous case of canine LTA were locally diagnosed. Results indicate the risk of LVA establishment in this region. Possible role of alternative vectors in leishmaniasis transmission is discussed.

Lutzomyia longipalpis (Diptera, Psychodidae) em Cuesta Basáltica, na bacia hidrográfica do Rio Corumbataí, Região Centro-leste do Estado de São Paulo

A incidência das leishmanioses tegumentar e visceral americanas, em especial esta última (LVA), em hospedeiros caninos e humanos, encontra-se em crescente processo de expansão no Estado de São Paulo. Para a vigilância epidemiológica dessas endemias, torna-se fundamental o conhecimento da distribuição e da ecologia das diferentes espécies da fauna flebotomínea vetoras. Assim, a divulgação de novos encontros de seus vetores, sobretudo da Lutzomyia longipalpis, o principal vetor da LVA, é fundamental para apontar novas áreas de risco para a transmissão dessas doenças. Neste estudo, capturas de flebotomíneos foram realizadas em ambiente domiciliar, peridomiciliar e de mata, em diferentes localidades rurais dos municípios de Ipeúna e Itirapina, entre outubro de 2001 e fevereiro de 2004. Foram utilizadas armadilhas luminosas automáticas do tipo CDC, das 18h às 8h, em 14 noites, resultando 420 horas de exposição. Foram capturados 177 flebotomíneos pertencentes a doze espécies. A espécie mais abundante, Nyssomyia neivai, apontada como a principal vetora de LTA no Estado, contribuiu com 85,4% dos espécimes capturados em Ipeúna. O encontro de Lutzomyia longipalpis em uma caverna em Itirapina, aponta para o risco de estabelecimento da LVA na área e a necessidade de mais estudos locais sobre sua ecologia, sobretudo em relação à ocupação de ambientes antrópicos.

Ecological aspects of the sandfly fauna (Diptera, Psychodidae) in an American cutaneous leishmaniasis endemic area under the influence of hydroelectric plants in Paranapanema river, State of Parana, Brazil

Introduction: An epidemiological study was undertaken to identify determinant factors in the occurrence of American cutaneous leishmaniasis in areas under the influence of hydroelectric plants in Paranapanema river, State of Parana, Brazil. The ecological aspects of the phlebotomine fauna were investigated. Methods: Sandflies were sampled with automatic light traps from February 2004 to June 2006 at 25 sites in the urban and rural areas of Itambaraca, and in Porto Almeida and Sao Joaquim do Pontal. Results: A total of 3,187 sandflies of 15 species were captured. Nyssomyia neivai predominated (34.4%), followed by Pintomyia pessoai (32.6%), Migonemyia migonei (11.6%), Nyssomyia whitmani (8.8%), and Pintomyia fischeri (2.7%), all implicated in the transmission of Leishmania. Males predominated for Ny. neivai, and females for the other vector species, with significant statistical differences (p < 0.001). Nyssomyia neivai, Pi. pessoai, Ny. whitmani, Brumptomyia brumpti, Mg. migonei, and Pi. fischeri presented the highest values for the Standardized Species Abundance Index (SSAI). The highest frequencies and diversities were found in the preserved forest in Porto Almeida, followed by forests with degradation in Sao Joaquim do Pontal and Vila Rural. Conclusions: Sandflies were captured in all localities, with the five vectors predominating. Ny. neivai had its highest frequencies in nearby peridomestic environments and Pi. pessoai in areas of preserved forests. The highest SSAI values of Ny. neivai and Pi. pessoai reflect their wider dispersion and higher frequencies compared with other species, which seems to indicate that these two species may be transmitting leishmaniasis in the area.

Geographical distribution of American cutaneous leishmaniasis and its phlebotomine vectors (Diptera: Psychodidae) in the state of São Paulo, Brazil

Abstract Background American cutaneous leishmaniasis (ACL) is a re-emerging disease in the state of São Paulo, Brazil. It is important to understand both the vector and disease distribution to help design control strategies. As an initial step in applying geographic information systems (GIS) and remote sensing (RS) tools to map disease-risk, the objectives of the present work were to: (i) produce a single database of species distributions of the sand fly vectors in the state of São Paulo, (ii) create combined distributional maps of both the incidence of ACL and its sand fly vectors, and (iii) thereby provide individual municipalities with a source of reference material for work carried out in their area. Results A database containing 910 individual records of sand fly occurrence in the state of São Paulo, from 37 different sources, was compiled. These records date from between 1943 to 2009, and describe the presence of at least one of the six incriminated or suspected sand fly vector species in 183/645 (28.4%) municipalities. For the remaining 462 (71.6%) municipalities, we were unable to locate records of any of the six incriminated or suspected sand fly vector species (Nyssomyia intermedia, N. neivai, N. whitmani, Pintomyia fischeri, P. pessoai and Migonemyia migonei). The distribution of each of the six incriminated or suspected vector species of ACL in the state of São Paulo were individually mapped and overlaid on the incidence of ACL for the period 1993 to 1995 and 1998 to 2007. Overall, the maps reveal that the six sand fly vector species analyzed have unique and heterogeneous, although often overlapping, distributions. Several sand fly species - Nyssomyia intermedia and N. neivai - are highly localized, while the other sand fly species - N. whitmani, M. migonei, P. fischeri and P. pessoai - are much more broadly distributed. ACL has been reported in 160/183 (87.4%) of the municipalities with records for at least one of the six incriminated or suspected sand fly vector species, while there are no records of any of these sand fly species in 318/478 (66.5%) municipalities with ACL. Conclusions The maps produced in this work provide basic data on the distribution of the six incriminated or suspected sand fly vectors of ACL in the state of São Paulo, and highlight the complex and geographically heterogeneous pattern of ACL transmission in the region. Further studies are required to clarify the role of each of the six suspected sand fly vector species in different regions of the state of São Paulo, especially in the majority of municipalities where ACL is present but sand fly vectors have not yet been identified.

Ecological aspects of the sandfly fauna (Diptera, Psychodidae) in an American cutaneous leishmaniasis endemic area under the influence of hydroelectric plants in Paranapanema river, State of Paraná, Brazil

INTRODUCTION: An epidemiological study was undertaken to identify determinant factors in the occurrence of American cutaneous leishmaniasis in areas under the influence of hydroelectric plants in Paranapanema river, State of Paraná, Brazil. The ecological aspects of the phlebotomine fauna were investigated. METHODS: Sandflies were sampled with automatic light traps from February 2004 to June 2006 at 25 sites in the urban and rural areas of Itambaracá, and in Porto Almeida and São Joaquim do Pontal. RESULTS: A total of 3,187 sandflies of 15 species were captured. Nyssomyia neivai predominated (34.4%), followed by Pintomyia pessoai (32.6%), Migonemyia migonei (11.6%), Nyssomyia whitmani (8.8%), and Pintomyia fischeri (2.7%), all implicated in the transmission of Leishmania. Males predominated for Ny. neivai, and females for the other vector species, with significant statistical differences (p < 0.001). Nyssomyia neivai, Pi. pessoai, Ny. whitmani, Brumptomyia brumpti, Mg. migonei, and Pi. fischeri presented the highest values for the Standardized Species Abundance Index (SSAI). The highest frequencies and diversities were found in the preserved forest in Porto Almeida, followed by forests with degradation in São Joaquim do Pontal and Vila Rural. CONCLUSIONS: Sandflies were captured in all localities, with the five vectors predominating. Ny. neivai had its highest frequencies in nearby peridomestic environments and Pi. pessoai in areas of preserved forests. The highest SSAI values of Ny. neivai and Pi. pessoai reflect their wider dispersion and higher frequencies compared with other species, which seems to indicate that these two species may be transmitting leishmaniasis in the area.

Developmental Rate Of Immatures Of Two Fly Species Of Forensic Importance: Sarcophaga (liopygia) Ruficornis And Microcerella Halli (diptera: Sarcophagidae).

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Phenotypic Polymorphism Of Chrysomya Albiceps (wiedemann) (diptera: Calliphoridae) May Lead To Species Misidentification.

Species identification is an essential step in the progress and completion of work in several areas of biological knowledge, but it is not a simple process. Due to the close phylogenetic relationship of certain species, morphological characters are not always sufficiently distinguishable. As a result, it is necessary to combine several methods of analysis that contribute to a distinct categorization of taxa. This study aimed to raise diagnostic characters, both morphological and molecular, for the correct identification of species of the genus Chrysomya (Diptera: Calliphoridae) recorded in the New World, which has continuously generated discussion about its taxonomic position over the last century. A clear example of this situation was the first record of Chrysomya rufifacies in Brazilian territory in 2012. However, the morphological polymorphism and genetic variability of Chrysomya albiceps studied here show that both species (C. rufifacies and C. albiceps) share very similar character states, leading to misidentification and subsequent registration error of species present in our territory. This conclusion is demonstrated by the authors, based on a review of the material deposited in major scientific collections in Brazil and subsequent molecular and phylogenetic analysis of these samples. Additionally, we have proposed a new taxonomic key to separate the species of Chrysomya found on the American continent, taking into account a larger number of characters beyond those available in current literature.

Competição larval em Chrysomya megacephala (F.) (Diptera: Calliphoridae): efeitos de diferentes níveis de agregação larval sobre estimativas de peso, fecundidade e investimento reprodutivo

In insects that utilize patchy and ephemeral resources for feeding and egg laying, the outcome of larval competition for food resources depends on the amount of resources and the spatial distribution of immatures among patches of food. In the present study, the results of larval competition for food in Chrysomya megacephala, in traits such as female weight, fecundity and reproductive investment, were different in situations where the level of larval aggregation (proportion of competitors per amount of food) was the same, but with densities of competitors and amounts of food proportionally different. These results are indicative that the larval competition may depend both on the larval density and the amount of food, in different situations with the same proportion of larvae per gram of food.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity.