845 resultados para LIGHT PENETRATION
Resumo:
The aim of this study was to determine the effect of two light-curing units (QTH and LED) on microleakage of Class II composite resin restorations with dentin cavosurface margins. Twenty extracted mandibular first premolars, free of caries and fractures were prepared two vertical slot cavities in the occluso-mesial and -destal surfaces (2 mm buccal-lingually, 2 mm proximal-axially and cervical limit in enamel) and divided into 4 equal groups (n = 8): GI and GII: packable posterior composite light-activated with LED and QTH, respectively; GIII and GIV: micro-hybrid composite resin light-activated with LED and QTH, respectively. The composite resins were applied following the manufacturer's instructions. After 24 h of water storage specimens were subjected to thermocycling for a total of 500 cycles at 5 and 55A degrees C and the teeth were then sealed with impermeable material. Teeth were immersed in 0.5% Basic fuchsin during 24 h at room temperature, and zero to three levels of penetration score were attributed. The Mann-Whitney and Kruskal-Wallis tests showed significant statistically similar (P > 0.05) from GI to GII and GIII to GIV, which the GII (2.750) had the highest mean scores and the GIII and GIV (0.875) had lowest mean scores. The use of different light-curing units has no influence on marginal integrity of Class II composite resin restorations and the proprieties of composite resins are important to reduce the microleakage.
Resumo:
The genus Actinocephalus comprises 25 species and is restricted to Brazil, occurring mainly in the Espinhaco Mountains of Minas Gerais and Bahia States. Previous anatomical studies have reported the occurrence of intracellular papillae in the Actinocephalus roots, without dealing with their ultrastructure and function. The purpose of this paper is to investigate the structure, the composition and the probable function of the intracellular papillae of Actinocephalus roots, based on light microscopy, transmission electron microscopy and histochemical tests. The intracellular papillae occurred in all root tissues, from the rhizodermis to the vascular cylinder; they presented different forms and sizes and, ultrastructurally, they corresponded to material deposited between the cell wall and the plasma membrane. The histochemical tests carried out were positive for cellulose, pectin and callose. The intracellular papillae are responses of the plant cells to the interaction with fungi. They work as a physical barrier restricting fungal penetration, and they may also favor the supply of water and nutrients to the plant, since they increase root absorption surface. This might explain why the species of Actinocephalus are among the tallest Eriocaulaceae despite their reduced radicular system and the nutritional deficiency of the soil in which they grow. (C) 2006 Elsevier Ltd. All rights reserved.
Resumo:
The purpose of this study was to investigate the penetration of an aggressive self-etching adhesive system at refrigerated and room temperatures into ground and unground enamel surfaces. Thirty extracted human teeth were used to measure adhesive penetration into enamel by light microscopy analysis (x400). The unground enamel surfaces were cleaned with pumice and water using a rotary dental brush. For each specimen, part of the unground enamel was manually ground and part was kept intact. A self-etch adhesive was evaluated for its ability to penetrate ground and unground enamel surfaces at room temperature (25 degrees C), at 30 minutes after removal from the refrigerator, and immediately after removal from the refrigerator (6 degrees C). Data were analyzed using variance and the Tukey test, which revealed significant differences in length of penetration of this material when applied on ground and unground enamel surfaces and between the different temperatures used (P > .05). The self-etching system used in this study had significantly lower penetration into unground enamel and at 6 degrees C (P < .05). No statistical difference was found between the interactions of these factors. It was concluded that the self-etching system produced the best penetration into ground enamel surface at room temperature (25 degrees C) and at 30 minutes after removing the specimens from the refrigerator.
Resumo:
O objetivo deste estudo foi determinar o efeito da polimerização gradual, mediante a utilização de aparelhos de Quartzo-Tungustênio-Halógena (QTH) e Arco de Plasma de Xenônio (PAC), no selamento marginal de restaurações classe V em resina composta com margens localizadas em dentina. Setenta e cinco incisivos bovinos receberam preparos de cavidades classe V, na raiz, com o intuito de situar as margens cavitárias em dentina. Os dentes foram divididos em cinco grupos de acordo com o método de fotoativação. As cavidades, depois de condicionadas, foram tratadas com o sistema adesivo Single Bond (3M Dental) e restauradas com a resina composta Z100 (3M Dental) pela técnica incremental. A fotoativação foi realizada para cada grupo como descrito a seguir: Grupo I: PAC pelo método de fotoativação constante: 1600mW/cm2 – 3s; Grupo II: PAC pelo método de fotoativação por passos (800mW/cm2 – 2s, subindo automaticamente para 1600mW/cm2 – 4s); Grupo III: QTH pelo método de fotoativação constante: 400 mW/cm2 – 40s; Grupo IV: QTH pelo método de fotoativação em rampa: 100 a 600 mW/cm2 – 15s, permanecendo a 600mW/cm2 por mais 25s; Grupo V: QTH pelo método de fotoativação por pulso: 200 mW/cm2 – 3s, tempo de espera de 3min.e a seguir 600mW/cm2 – 30s. Os dentes foram armazenados em água destilada a 37ºC por 30 dias e então submetidos à ciclagem térmica, por 500 ciclos à 5 ºC e 55 ºC. Os ápices dos dentes foram selados com resina composta e os dentes foram cobertos com duas camadas de esmalte para unha, antes da sua imersão em fucsina básica a 0,5%. Os dentes foram seccionados e os cortes foram escaneados para avaliação da área infiltrada por corante por um programa de computador (Image Tools). Os cortes foram também visualizados com lupa para a determinação do grau de penetração do corante na interface dente-restauração por escores. Diferenças estatisticamente significantes foram observadas entre os grupos quanto ao grau e à área de penetração de corante (p < 0,05). Os grupos I e II apresentaram valores significantemente mais altos de infiltração e penetração do corante que os grupos III, IV e V. Em conclusão, o uso da fonte de PAC, no modo constante e por passos, resultou em valores significantemente maiores de infiltração marginal quando comparados com a intensidade de luz média emitida pelos aparelhos de QTH. Os métodos de fotoativação por pulso, rampa e continuo com a fonte de QTH resultaram num grau similar de microinfiltração.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
This aim of the present study was to evaluate the pulp chamber penetration of 35% hydrogen peroxide activated by LED (light-emitting diode) or Nd:YAG laser in bovine teeth, after an in-office bleaching technique. Forty-eight bovine lateral incisors were divided into four groups, acetate buffer was placed into the pulp chamber and bleaching agent was applied as follows: for group A (n = 12), activation was performed by LED; for group B (n = 12), activation was performed by Nd:YAG laser (60 mJ, 20 Hz); group C (n = 12) received no light or laser activation; and the control group (n = 12) received no bleaching gel application or light or laser activation. The acetate buffer solution was transferred to a glass tube and Leuco Crystal Violet and horseradish peroxidase were added, producing a blue solution. The optical density of this solution was determined spectrophotometrically and converted into microgram equivalents of hydrogen peroxide. The results were analysed using ANOVA and Tukey's test (5%). It was verified that the effect of activation was significant, as groups activated by LED or laser presented greater hydrogen peroxide penetration into the pulp chamber (0.499 +/- 0.622 microg) compared with groups that were not (0.198 +/- 0.218 microg). There was no statistically significant difference in the penetration of hydrogen peroxide into the pulp chamber between the two types of activation (LED or laser). The results suggest that activation by laser or LED caused an increase in hydrogen peroxide penetration into the pulp chamber.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Topical photodynamic therapy (PDT) has been applied to almost all types of nonmelanoma skin cancer and numerous superficial benign skin disorders. Strategies to improve the accumulation of photosensitizer in the skin have been studied in recent years. Although the hydrophilic phthalocyanine zinc compound, zinc phthalocyanine tetrasulfonate (ZnPcSO4) has shown high photodynamic efficiency and reduced phototoxic side effects in the treatment of brain tumors and eye conditions, its use in topical skin treatment is currently limited by its poor skin penetration. In this study, nanodispersions of monoolein (MO)-based liquid crystalline phases were studied for their ability to increase ZnPcSO4 uptake by the skin. Lamellar, hexagonal and cubic crystalline phases were prepared and identified by polarizing light microscopy, and the nanodispersions were analyzed by dynamic light scattering. In vitro skin penetration studies were performed using a Franz's cell apparatus, and the skin uptake was evaluated in vivo in hairless mice. Aqueous dispersions of cubic and hexagonal phases showed particles of nanometer size, approximately 224 +/- 10 nm and 188 +/- 10 nm, respectively. In vitro skin retention experiments revealed higher fluorescence from the ZnPcSO4 in deeper skin layers when this photosensitizer was loaded in the hexagonal nanodispersion system when compared to both the cubic phase nanoparticles and the bulk crystalline phases (lamellar, cubic and hexagonal). The hexagonal nanodispersion showed a similar penetration behavior in animal tests. These results are important findings, suggesting the development of MO liquid crystal nanodispersions as potential delivery systems to enhance the efficacy of topical PDT.
Resumo:
Objective: The purpose of this study was to investigate the rat skin penetration abilities of two commercially available low-level laser therapy (LLLT) devices during 150 sec of irradiation. Background data: Effective LLLT irradiation typically lasts from 20 sec up to a few minutes, but the LLLT time-profiles for skin penetration of light energy have not yet been investigated. Materials and methods: Sixty-two skin flaps overlaying rat's gastrocnemius muscles were harvested and immediately irradiated with LLLT devices. Irradiation was performed either with a 810 nm, 200mW continuous wave laser, or with a 904 nm, 60mW superpulsed laser, and the amount of penetrating light energy was measured by an optical power meter and registered at seven time points (range, 1-150 sec). Results: With the continuous wave 810nm laser probe in skin contact, the amount of penetrating light energy was stable at similar to 20% (SEM +/- 0.6) of the initial optical output during 150 sec irradiation. However, irradiation with the superpulsed 904 nm, 60mW laser showed a linear increase in penetrating energy from 38% (SEM +/- 1.4) to 58% (SEM +/- 3.5) during 150 sec of exposure. The skin penetration abilities were significantly different (p < 0.01) between the two lasers at all measured time points. Conclusions: LLLT irradiation through rat skin leaves sufficient subdermal light energy to influence pathological processes and tissue repair. The finding that superpulsed 904nm LLLT light energy penetrates 2-3 easier through the rat skin barrier than 810nm continuous wave LLLT, corresponds well with results of LLLT dose analyses in systematic reviews of LLLT in musculoskeletal disorders. This may explain why the differentiation between these laser types has been needed in the clinical dosage recommendations of World Association for Laser Therapy.
Resumo:
Background. The use of external sources of energy may accelerate the setting rate of glass ionomer cements (GICs) allowing better initial mechanical properties. Aim. To investigate the influence of ultrasound and halogen light on the microleakage and hardness of enamel adjacent to GIC restorations, after artificial caries challenge. Design. Cavities were prepared in 60 primary canines, restored with GIC, and randomly distributed into three groups: control group (CG), light group (LG) - irradiation with a halogen lightcuring unit for 60 s, and ultrasonic group (UG) application of ultrasonic scaler device for 15 s. All specimens were then submitted to a cariogenic challenge in a pH cycling model. Half of sample in each group were immersed in methylene blue for 4 h and sectioned for dye penetration analysis. The remaining specimens were submitted to Knoop cross-sectional microhardness assessments, and mineral changes were calculated for adjacent enamel. Results. Data were compared using Kruskal-Wallis test and two- way ANOVA with 5% significance. Higher dye penetration was observed for the UG (P < 0.01). No significant mineral changes were observed between groups (P = 0.844). Conclusion. The use of halogen light- curing unit does not seem to interfere with the properties of GICs, whereas the use of ultrasound can affect its marginal sealing.
Resumo:
OBJECTIVES AND METHODS: This study investigated the sealing ability of a current available unfilled fissure sealant applied over sound (n=80), artificially created (n=80) and naturally carious fissures (n=80) under different humidity conditions (90+/-2 and 45+/-2% relative humidity) and etching times (40 and 60s). All samples were submitted to 5000 thermal cycles and examined by light microscopy after sectioning. Microleakage, penetration ability, fissure type, fissure entrance angle, sealant occlusal length, caries location and caries depth were assessed. RESULTS: The significantly longer sealant occlusal length and larger entrance angle exhibited by shallow fissures, contributed to their higher microleakage and smaller amounts of unfilled areas compared to deep fissures. Sealant microleakage was significantly influenced by the condition of the enamel (sound, artificial and natural caries) and the caries location in the fissures, but not by enamel caries depth (D1 and D2), etching time, or humidity condition. Natural caries exhibited significantly higher microleakage than sound or artificially created carious fissures. CONCLUSIONS: Based on the results of this study, it can be concluded that location of caries in the fissure rather than its depth should be taken into account when applying a fissure sealant. When the borders of the fissure sealant are on carious enamel, a significantly higher microleakage must be expected. The artificial caries model was not a suitable method to assess the behavior of natural fissure caries.
Resumo:
Current data indicate that the size of high-density lipoprotein (HDL) may be considered an important marker for cardiovascular disease risk. We established reference values of mean HDL size and volume in an asymptomatic representative Brazilian population sample (n=590) and their associations with metabolic parameters by gender. Size and volume were determined in HDL isolated from plasma by polyethyleneglycol precipitation of apoB-containing lipoproteins and measured using the dynamic light scattering (DLS) technique. Although the gender and age distributions agreed with other studies, the mean HDL size reference value was slightly lower than in some other populations. Both HDL size and volume were influenced by gender and varied according to age. HDL size was associated with age and HDL-C (total population); non- white ethnicity and CETP inversely (females); HDL-C and PLTP mass (males). On the other hand, HDL volume was determined only by HDL-C (total population and in both genders) and by PLTP mass (males). The reference values for mean HDL size and volume using the DLS technique were established in an asymptomatic and representative Brazilian population sample, as well as their related metabolic factors. HDL-C was a major determinant of HDL size and volume, which were differently modulated in females and in males.
Resumo:
The human mitochondrial Hsp70, also called mortalin, is of considerable importance for mitochondria biogenesis and the correct functioning of the cell machinery. In the mitochondrial matrix, mortalin acts in the importing and folding process of nucleus-encoded proteins. The in vivo deregulation of mortalin expression and/or function has been correlated with age-related diseases and certain cancers due to its interaction with the p53 protein. In spite of its critical biological roles, structural and functional studies on mortalin are limited by its insoluble recombinant production. This study provides the first report of the production of folded and soluble recombinant mortalin when co-expressed with the human Hsp70-escort protein 1, but it is still likely prone to self-association. The monomeric fraction of mortalin presented a slightly elongated shape and basal ATPase activity that is higher than that of its cytoplasmic counterpart Hsp70-1A, suggesting that it was obtained in the functional state. Through small angle X-ray scattering, we assessed the low-resolution structural model of monomeric mortalin that is characterized by an elongated shape. This model adequately accommodated high resolution structures of Hsp70 domains indicating its quality. We also observed that mortalin interacts with adenosine nucleotides with high affinity. Thermally induced unfolding experiments indicated that mortalin is formed by at least two domains and that the transition is sensitive to the presence of adenosine nucleotides and that this process is dependent on the presence of Mg2+ ions. Interestingly, the thermal-induced unfolding assays of mortalin suggested the presence of an aggregation/association event, which was not observed for human Hsp70-1A, and this finding may explain its natural tendency for in vivo aggregation. Our study may contribute to the structural understanding of mortalin as well as to contribute for its recombinant production for antitumor compound screenings.
Resumo:
To evaluate the influence of light-activation of second, third and fourth increments on degree of conversion (DC) and microhardness (KHN) of the top (T) and bottom (B) surface of the first increment. Forty samples (n = 5) were prepared. In groups 1-4, after each increment light-activation (multiple irradiation), T and B of the first increment were measured in DC and KHN. In groups 5-8, only the first increment was made (single irradiation) and measurements of DC and KHN were taken at 15 min intervals. The light-activation modes were (XL) 500 mW/cm(2) × 38 s (G1/G5); (S) 1000 mW/cm(2) × 19 s (G2/G6), (HP) 1400 mW/cm(2) × 14 s (G3/G7); (PE) 3200 mW/cm(2) × 6 s (G4/G8). Data for DC and KHN were analyzed separately by using PROC MIXED for repeated measures and Tukey-Kramer test (α = 0.05). For KHN, B showed lower values than T. PE resulted in lower values of KHN in B surface. For single and multiple irradiations, T and B of first measurement showed the lowest KHN and the fourth measurement showed the highest, with significant difference between them. For single irradiation, first and second increments presented similar KHN, different from the third and fourth increment, which did not differ between them. For multiple irradiations, the second light-activation resulted in KHN similar to first, third and fourth increments. For DC, except QTH, T presented higher DC than B. The light-activation of successive increments was not able to influence the KHN and DC of the first increment.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.