Synthesis and x-ray structure of a highly symmetrical selenium-centered hexanuclear neodymium complex, [(Cp6Nd6Se13)-Nd-t](-) (Cp-t=eta(5)-(BuC5H4)-C-t)

The half-sandwich tert-buthylcyclopentadienyl neodymium complex [(CpNdCl2)-Nd-t(THF)(2)](2) (1) reacts with Na2Se5 to give organoneodymium polyselenide complex [Na(THF)(6)][(Cp6Nd6)-Nd-t(mu(6)-Se)(mu(2)-Se-2)(6)] (2) which has been characterized by X-ray crystallography.

SYNTHESIS AND X-RAY CRYSTAL-STRUCTURE OF AN ORGANOLANTHANIDE COMPLEX [(BU(T)CP)3NDBRLI(THF)3]

(ButCp)2NdCl.2THF reacts with one equivalent of phenyllithum in THF yielding tris(tert-butylcyclopentadienyl)neodymium lithium bromide tetrahydrofuran, [(ButCP)3 NdBrLi(THF)3], as a by-product, whose structure has been determined by X-ray crystallography. The 10-coordinated neodymium atom is bonded to three tert-butyl-cyclopentadienyl groups and one bromine atom, forming a distorted pseudo-tetrahedron.

Central nervous system drugs: Low temperature X-ray structures of (I) the base 5-(2,3-dichlorophenyl)-2,4-diamino-6-fluoromethyl-pyrimidine (4030W92) and (II) 5-(2,6-dichlorophenyl)-1-H-2,4-diamino-6-methyl-pyrimidine methanesulphonic acid salt (227C89)

The X-ray crystal structures of (I), the base 4030W92, 5-(2,3-dichlorophenyl)-2,4-diamino-6-fluoromethyl-pyrimidine, C11H9Cl2FN4, and (II) 227C89, the methanesulphonic acid salt of 5-(2,6-dichlorophenyl)-1-H-2,4-diamino-6-methyl-pyrimidine, C11H11Cl2N4 center dot CH3O3S, have been carried out at low temperature. A detailed comparison of the two structures is given. Structure (I) is non-centrosymmetric, crystallizing in space group P2(1) with unit cell a = 10.821(3), b = 8.290(3), c = 13.819(4) angstrom, beta = 105.980(6)degrees, V = 1191.8(6) angstrom(3), Z = 4 (two molecules per asymmetric unit) and density (calculated) = 1.600 mg/m(3). Structure (II) crystallizes in the triclinic space group P (1) over bar with unit cell a = 7.686(2), b = 8.233(2), c = 12.234(2) angstrom, alpha = 78.379(4), beta = 87.195(4), gamma = 86.811(4)degrees, V = 756.6(2) angstrom(3), Z = 2, density (calculated) = 1.603 mg/m(3). Final R indices [I > 2sigma(I)] are R1 = 0.0572, wR2 = 0.1003 for (I) and R1 = 0.0558, wR2 = 0.0982 for (II). R indices (all data) are R1 = 0.0983, wR2 = 0.1116 for (I) and R1 = 0.1009, wR2 = 0.1117 for (II). 5- Phenyl-2,4 diaminopyrimidine and 6-phenyl-1,2,4 triazine derivatives, which include lamotrigine (3,5-diamino-6-(2,3-dichlorophenyl)-1,2,4-triazine), have been investigated for some time for their effects on the central nervous system. The three dimensional structures reported here form part of a newly developed data base for the detailed investigation of members of this structural series and their biological activities.

Low temperature X-ray structures of two crystalline forms (I) and (II) of the pyrimidine derivative and sodium channel blocker BW1003C87: 5-(2,3,5-trichlorophenyl)-2,4-diaminopyrimidine

The X-ray crystal structures of two crystalline forms of 5-(2,3,5-trichlorophenyl)-2,4-diaminopyrimidine, C10H7Cl3N4 (code name BW1003C87) (I) and (II), have been carried out at liquid nitrogen temperature. A detailed comparison of the two structures is given. Both are centrosymmetric, with structure (I) in the triclinic space group P (1) over bar unit cell a = 6.4870(10), b = 9.216(2), c = 12.016(2) angstrom, alpha = 75.78(3)degrees, beta = 89.95(3)degrees, gamma = 83.45(3)degrees, V = 691.5(2) angstrom(3), Z = 2 and density (calculated) = 1.544 Mg/m(3); and (II) in the monoclinic space group P2(1)/c, unit cell a = 12.000(2), b = 7.518(2), c = 13.450(3) angstrom, beta = 97.87(3)degrees, V = 1202.0(5) angstrom(3), Z = 4, Density (calculated) = 1.600 Mg/m(3). Structure (I) includes a solvated CH3OH in the lattice. Final R indices [I > 2sigma(I)] are R1 = 0.0427, wR2 = 0.1075 for (I) and R1 = 0.0487, wR2 = 0.1222 for (II). R indices (all data) are R1 = 0.0470, wR2 = 0.1118 for (I) and R1 = 0.0623, wR2 = 0.1299 for (II). 5-Phenyl-2,4 diaminopyrimidine and 6-phenyl-1,2,4 triazine derivatives, which include lamotrigine (3,5-diamino-6-(2,3-dichlorophenyl)-1,2,4-triazine), have been investigated for some time for their effects on the central nervous system. Both lamotrigine and 5-(2,3,5-trichlorophenyl)-2,4-diaminopyrimidine (code name BW1003C87), the subject of the present study, are anticonvulsant as well as neuroprotective in models of brain ischaemia and in a model of white matter ischaemia. BW1003C87 is a sodium channel blocker which also reduces the release of the neurotransmitter glutamate. The three dimensional structures reported here form part of a newly developed data base for the detailed investigation of members of this drug family and their biological activities.

X-ray crystallographic structures of two lamotrigine analogues: (I) 3,5-diamino-6-(2-chlorophenyl)-1,2,4-triazine water solvate and (II) 3,5-diamino-6-(3,6-dichlorophenyl)-1,2,4-triazine methanol solvate

The X-ray crystal structures of two lamotrigine derivatives (I) 3,5-diamino-6-(2-chlorophenyl)-1,2,4-triazine, C9H8ClN5, (465BL) as a hydrate, and (II) 3,5-diamino-6-(3,6-dichlorophenyl)-1,2,4-triazine, C9H7Cl2N5, (469BR) as a methanol solvate, have been carried out at liquid nitrogen temperature and room temperature, respectively. A detailed comparison of the two structures is given. Both are centrosymmetric with (I) in the orthorhombic space group Pbca, a = 12.2507(3), b = 15.7160(6), c = 21.71496(9) angstrom, Z = 16, and (II) in the monoclinic space group C2/c, a = 38.553(3), b = 4.9586(2), c = 14.546(2) angstrom, beta = 111.59(1)degrees, Z = 8. Final R indices [I > 2sigma(I)] for (I) are R1 = 0.0670, wR2 = 0.1515 and for (II) R1 = 0.0434, wR2 = 0.1185. Structure (I) has water of crystallization in the lattice and (II) includes a solvated CH3OH. Structure (I) is characterized by having two crystallographically independent molecules, A and B, of 465BL, per asymmetric unit. Molecule B has a very unusual feature in that the 2-chlorophenyl ring is statistically disordered, occupying site (1) in 87.5% of the structure and site (2) in 12.5% of the structure. Sites (1) and (2) are related by an exact 180 degrees pivot of the phenyl ring about the ring linkage bond. The presence of two independent molecules per asymmetric unit provides an ideal opportunity for the conformational flexibility of the molecule 465BL to be studied. Structure (I) also includes a further unusual feature in that the lattice contains one fully occupied water molecule and an additional solvated water which is only 33% occupied.

Low temperature X-ray crystallographic structures of two lamotrigine analogues: (I) 2-methyl,3-amino, 5-imino-6-(2,3-dichlorophenyl)-1,2,4-triazine water solvate and (II) 2-methyl,3,5-diamino-6-(2,3-dichlorophenyl)-1,2,4-triazine isethionate, hemi-hydrate

The X-ray crystal structures of two lamotrigine derivatives (I) 2-methyl, 3-amino, 5-imino-6-(2, 3-dichlorophenyl)-1,2,4-triazine, C10H9Cl2N5, as the hemi hydrate and (II) 2-methyl,3,5-diamino-6-(2,3-dichlorophenyl)-1,2,4-triazine, C10H10Cl2N5, as the isethionate-water solvate, have been carried out at liquid nitrogen temperature. A detailed comparison of the two structures is given. Both are monoclinic and centrosymmetric, with (I) in space group C2/c, and (II) in space group P2(1)/n. For (I) the unit cell dimensions are a = 19.5466(10), b = 7.5483(4), c = 15.7861(8) angstrom, beta = 91.458(3)degrees, volume = 2328.4(2) angstrom(3), Z = 8, density = 1.590 Mg/m(3); for (II). For (II) the unit cell dimensions are a = 6.0566(2), b = 11.0084(4) c = 23.9973(9) angstrom, beta = 92.587(3)degrees, volume = 1598.35(10) angstrom(3), Z = 4, density = 1.597 Mg/m(3). For (I) final R indices [I > 2sigma(I)] are R1 = 0.0356, wR2 = 0.0782 and R indices (all data) are R1 = 0.0424, wR2 = 0.0817. For (II) final R indices [I > 2sigma(I)] are R1 = 0.0380, wR2 = 0.0871 and R indices (all data) R1 = 0.0558, wR2 = 0.0949. Both structures have a molecule of water of crystallization and (II) also includes a solvated CH3SO3. Comparisons are made between the two structures. Structure (I) is very unusual in having a = NH group at position C5' on the triazine ring. No other examples of this particular substitution, which is usually -NH2, have been reported.

X-ray crystallographic structures of neuroprotective pyrimidine derivatives: (I) the mesylate salt of BW1003C87 and (II) sipatrigine base

Drugs based on 5-phenyl-2,4 diamino pyrimidine and 6-phenyl-1,2,4 triazine derivatives are well known for their effects on the central nervous system. The study presented here provides detailed crystal structures of two pyrimidine derivatives which have neuroprotective properties in models of both grey and white matter ischemia. Recently published studies suggest that the compounds lamotrigine (a triazine derivative), and the two pyrimidines BW1003C87 (I) and sipatrigine (II) mediate their primary in vivo mode of action by inhibiting voltage-gated Na+ channels. The X-ray crystal structures will contribute valuable data for applications involving binding and modelling studies of the biological actions of these drugs.

Crystallization and preliminary X-ray diffraction analysis of naphthalene dioxygenase from Rhodococcus sp strain NCIMB 12038

The three-component naphthalene dioxygenase (NDO) enzyme system carries out the first step in the aerobic degradation of naphthalene to (+)-cis-(1R,2S)-dihydroxy-1,2-dihydronaphthalene by Rhodococcus sp. strain NCIMB 12038. The terminal oxygenase component (naphthalene 1,2-dioxygenase) that catalyzes this reaction belongs to the aromatic ring hydroxylating dioxygenase family and has been crystallized. These enzymes utilize a mononuclear nonheme iron centre to catalyze the addition of dioxygen to their respective substrates. In this reaction, two electrons, two protons and a dioxygen molecule are consumed. The Rhodococcus enzyme has only 33 and 29% sequence identity to the corresponding alpha- and beta-subunits of the NDO system of Pseudomonas putida NCIMB 9816-4, for which the tertiary structure has been reported. In order to determine the three-dimensional structure of the Rhodococcus NDO, diffraction-quality crystals have been prepared by the hanging-drop method. The crystals belongs to space group P2(1)2(1)2(1), with unit-cell parameters a = 87.5, b = 144, c = 185.6 Angstrom, alpha = beta = gamma = 90degrees, and diffract to 2.3 Angstrom resolution.

An EXAFS, X-ray diffraction, and electrochemical investigation of 1-alkyl-3-methylimidazolium salts of [{UO2(NO3)(2)}(2)(mu(4)-C2O4)](2-)

The structure of the 1-alkyl-3-methylimidazolium salts of the dinuclear mu(4)-(O,O,O',O'-ethane-1,2-dioato)-bis[bis(nitrato-O,O)dioxouranate(VI)] anion have been investigated using single crystal X-ray crystallography. In addition, EXAFS and electrochemical studies have been performed on the [C(4)mim](+) salt which is formed following the oxidative dissolution of uranium(IV) oxide in [C(4)mim][NO3]. EXAFS analysis of the solution following UO2 dissolution indicates a mixture of uranyl nitrate and mu(4)-(O,O,O',O'-ethane-1,2-dioato)-bis[bis(nitrato-O,O)dioxouranate(VI)] anions are formed.

Mid-Century Molecular: The Material Culture of X-ray Crystallographic Visualisation across Postwar British Science and Industrial Design

This thesis investigates the use and significance of X-ray crystallographic visualisations of molecular structures in postwar British material culture across scientific practice and industrial design. It is based on research into artefacts from three areas: X-ray crystallographers’ postwar practices of visualising molecular structures using models and diagrams; the Festival Pattern Group scheme for the 1951 Festival of Britain, in which crystallographic visualisations formed the aesthetic basis of patterns for domestic objects; and postwar furnishings with a ‘ball-and-rod’ form and construction reminiscent of those of molecular models. A key component of the project is methodological. The research brings together subjects, themes and questions traditionally covered separately by two disciplines, the history of design and history of science. This focus necessitated developing an interdisciplinary set of methods, which results in the reassessment of disciplinary borders and productive cross-disciplinary methodological applications. This thesis also identifies new territory for shared methods: it employs network models to examine cross-disciplinary interaction between practitioners in crystallography and design, and a biographical approach to designed objects that over time became mediators of historical narratives about science. Artefact-based, archival and oral interviewing methods illuminate the production, use and circulation of the objects examined in this research. This interdisciplinary approach underpins the generation of new historical narratives in this thesis. It revises existing histories of the cultural transmissions between X-ray crystallography and the production and reception of designed objects in postwar Britain. I argue that these transmissions were more complex than has been acknowledged by historians: they were contingent upon postwar scientific and design practices, material conditions in postwar Britain and the dynamics of historical memory, both scholarly and popular. This thesis comprises four chapters. Chapter one explores X-ray crystallographers’ visualisation practices, conceived here as a form of craft. Chapter two builds on this, demonstrating that the Festival Pattern Group witnesses the encounter between crystallographic practice, design practice and aesthetic ideologies operating within social networks associated with postwar modernisms. Chapters three and four focus on ball-and-rod furnishings in postwar and present-day Britain, respectively. I contend that strong relationships between these designed objects and crystallographic visualisations, for example the appellation ‘atomic design’, have been largely realised through historical narratives active today in the consumption of ‘retro’ and ‘mid-century modern’ artefacts. The attention to contemporary historical narratives necessitates this dual historical focus: the research is rooted in the period from the end of the Second World War until the early 1960s, but extends to the history of now. This thesis responds to the need for practical research on methods for studying cross-disciplinary interactions and their histories. It reveals the effects of submitting historical subjects that are situated on disciplinary boundaries to interdisciplinary interpretation. Old models, such as that of unidirectional ‘influence’, subside and the resulting picture is a refracted one: this study demonstrates that the material form and meaning of crystallographic visualisations, within scientific practice and across their use and echoes in designed objects, are multiple and contingent.

The measured variation of the Debye-Waller factor of aluminum from 295K to 815K by using the energy dispersive x-ray diffraction technique

The Energy Dispersive X-ray Diffraction System at Brock University has been used to measure the intensities of the diffraction lines of aluminum powder sample as a function of temperature. At first, intensity measurements at high temperature were not reproducible. After some modifications have been made, we were able to measure the intensities of the diffraction lines to 815K, with good accuracy and reproducibility. Therefore the changes of the Debye-Waller factor from room temperature up to 815K for aluminum were determined with precision. Our results are in good agreement with those previously published.

X-ray diffraction from Al powder using energy dispersive technique

Using the energy dispersive x ...ray diffraction (EDXD) technique, the room temperature diffraction pattern of Al powder was obtained at diffraction angles ~ 30° and 50°. From the small angle diffraction pattern the average relative intensities (IR) of the (111), (200), and (220) lines were measured to be equal to 100, 62, and 32 respectively. From the large diffraction angle IR for the (220), (311+222), (400), (331+420), and (422) lines were measured to be 100,201,17,90, and 19.5 respectively. The diffraction pattern at those two angles were obtained at several higher temperatures to measure the change in the intensities of the Al lines. From the intensity changes the increase of the Debye- Waller temperature factor, i.e ~B(T), with respect to the value at room temperature was determined to be 0.6+0.1 at 250°C, 1.10+0.15 at 350°C, 1.45+0.20 at 450°C, and 2.20±0.35 at 550°C.

Syntheses, characterization and X-ray crystal structures of Ni(II) complexes of tridentate monocondensed and tetradentate dicondensed Schiff bases

Two octahedral complexes [Ni(HL1)(2)](ClO4)(2) (1) and [Ni(HL2)(2)](ClO4)(2) (2) and a square planar complex [Ni(HL3)]ClO4 (3) have been prepared, where [HL1 = 3-(2-amino-ethylimino)-butan-2-one oxime, HL2 = 3-(2-amino-propylimino)butan-2-one oxime] and H2L3 = 3-[2-(3-hydroxy-1-methyl-but-2-enylideneamino)-1-methyl-ethylimino]-buta n-2-one oxime. All the complexes have been characterized by elemental analyses, spectral studies and room temperature magnetic moment measurements. The molecular structures of all three compounds were elucidated on the basis of X-ray crystallography: complexes 1 and 2 are seen to be the met isomers. (C) 2008 Elsevier Ltd. All rights reserved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.