912 resultados para Core promoter


Relevância:

30.00% 30.00%

Publicador:

Resumo:

γ-Crystallin genes are specifically expressed in the eye lens. Their promoters constitute excellent models to analyse tissue-specific gene expression. We investigated murine Cryge/f promoters of different length in lens epithelial cell lines. The most active fragment extends from position –219 to +37. Computer analysis predicts homeodomain and paired-domain binding sites for all rodent Crygd/e/f core promoters. As examples, we analysed the effects of Prox1 and Six3, which are considered important transcription factors involved in lens development. Because of endogenous Prox1 expression in N/N1003A cells, a weak stimulation of Cryge/f promoter activity was found for PROX1. In contrast, PROX1 stimulated the Crygf promoter 10-fold in CD5A cells without endogenous PROX1. In both cell lines Six3 repressed the Crygf promoter to 10% of its basal activity. Our cell transfection experiments indicated that Cryg expression increases as Six3 expression decreases. Prox1 and Six3 act antagonistically on regulation of the Crygd/e/f promoters. Functional assays using randomly mutated γF-crystallin promoter fragments define a Six3-responsive element between –101 and –123 and a Prox1-responsive element between –151 and –174. Since Prox1 and Six3 are present at the beginning of lens development, expression of Crygd/e/f is predicted to remain low at this time. It increases as Six3 expression decreases during ongoing lens development.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The mouse mammary tumor virus (MMTV) promoter is regulated by steroid hormones through a hormone-responsive region that is organized in a positioned nucleosome. Hormone induction leads to a structural change of this nucleosome which makes its DNA more sensitive to cleavage by DNase I and enables simultaneous binding of all relevant transcription factors. In cells carrying either episomal or chromosomally integrated MMTV promoters, moderate acetylation of core histones, generated by treatment with low concentrations of the histone deacetylase inhibitors sodium butyrate or trichostatin A, enhances transcription from the MMTV promoter in the absence of hormone and potentiates transactivation by either glucocorticoids or progestins. At higher concentrations, histone deacetylase inhibitors reduce basal and hormone induced MMTV transcription. Inducing inhibitor concentrations lead to the same type of nucleosomal DNase I hypersensitivity as hormone treatment, suggesting that moderate acetylation of core histone activates the MMTV promoter by mechanisms involving chromatin remodeling similar to that generated by the inducing hormones.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In the presence of m-xylene, the Pu promoter of the TOL plasmid of Pseudomonas putida is activated by the prokaryotic enhancer-binding protein XylR. The intervening DNA segment between the upstream activating sequences (UASs) and those for RNA polymerase binding contains an integration host factor (IHF) attachment site that is required for full transcriptional activity. In the absence of IHF, the Pu promoter can be cross-activated by other members of the sigma 54-dependent family of regulatory proteins. Such illegitimate activation does not require the binding of the heterologous regulators to DNA and it is suppressed by bent DNA structures, either static or protein induced, between the promoter core elements (UAS and RNA polymerase recognition sequence). The role of IHF in some sigma 54 promoters is, therefore, not only a structural aid for assembling a correct promoter geometry but also that of an active suppressor (restrictor) of promiscuous activation by heterologous regulators for increased promoter specificity.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Using the two largest collections of Mus musculus and Homo sapiens transcription start sites ( TSSs) determined based on CAGE tags, ditags, full- length cDNAs, and other transcript data, we describe the compositional landscape surrounding TSSs with the aim of gaining better insight into the properties of mammalian promoters. We classified TSSs into four types based on compositional properties of regions immediately surrounding them. These properties highlighted distinctive features in the extended core promoters that helped us delineate boundaries of the transcription initiation domain space for both species. The TSS types were analyzed for associations with initiating dinucleotides, CpG islands, TATA boxes, and an extensive collection of statistically significant cis- elements in mouse and human. We found that different TSS types show preferences for different sets of initiating dinucleotides and ciselements. Through Gene Ontology and eVOC categories and tissue expression libraries we linked TSS characteristics to expression. Moreover, we show a link of TSS characteristics to very specific genomic organization in an example of immune- response- related genes ( GO: 0006955). Our results shed light on the global properties of the two transcriptomes not revealed before and therefore provide the framework for better understanding of the transcriptional mechanisms in the two species, as well as a framework for development of new and more efficient promoter- and gene- finding tools.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The first theoretical results of core-valence correlation effects are presented for the infrared wavenumbers and intensities of the BF3 and BCl3 molecules, using (double- and triple-zeta) Dunning core-valence basis sets at the CCSD(T) level. The results are compared with those calculated in the frozen core approximation with standard Dunning basis sets at the same correlation level and with the experimental values. The general conclusion is that the effect of core-valence correlation is, for infrared wavenumbers and intensities, smaller than the effect of adding augmented diffuse functions to the basis set, e.g., cc-pVTZ to aug-cc-pVTZ. Moreover, the trends observed in the data are mainly related to the augmented functions rather than the core-valence functions added to the basis set. The results obtained here confirm previous studies pointing out the large descrepancy between the theoretical and experimental intensities of the stretching mode for BCl3.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A temperature pause introduced in a simple single-step thermal decomposition of iron, with the presence of silver seeds formed in the same reaction mixture, gives rise to novel compact heterostructures: brick-like Ag@Fe3O4 core-shell nanoparticles. This novel method is relatively easy to implement, and could contribute to overcome the challenge of obtaining a multifunctional heteroparticle in which a noble metal is surrounded by magnetite. Structural analyses of the samples show 4 nm silver nanoparticles wrapped within compact cubic external structures of Fe oxide, with curious rectangular shape. The magnetic properties indicate a near superparamagnetic like behavior with a weak hysteresis at room temperature. The value of the anisotropy involved makes these particles candidates to potential applications in nanomedicine.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

ANKHD1 (Ankyrin repeat and KH domain-containing protein 1) is highly expressed and plays an important role in the proliferation and cell cycle progression of multiple myeloma (MM) cells. ANKHD1 downregulation modulates cell cycle gene expression and upregulates p21 irrespective of the TP53 mutational status of MM cell lines. The present study was aimed to investigate the role of ANKHD1 in MM in vitro clonogenicity and in vivo tumourigenicity, as well as the role of ANKHD1 in p21 transcriptional regulation. ANKHD1 silencing in MM cells resulted in significantly low no. of colonies formed and in slow migration as compared to control cells (p < 0.05). Furthermore, in xenograft MM mice models, tumour growth was visibly suppressed in mice injected with ANKHD1 silenced cells compared to the control group. There was a significant decrease in tumour volume (p = 0.006) as well as in weight (p = 0.02) in the group injected with silenced cells compared to those of the control group. Co-immunoprecipitation and chromatin immunoprecipitation (ChIP) assays confirmed the interaction between p21 and ANKHD1. Moreover, overexpression of ANKHD1 downregulated the activity of a p21 promoter in luciferase assays. Decrease in luciferase activity suggests a direct role of ANKHD1 in p21 transcriptional regulation. In addition confocal analysis after U266 cells were treated with Leptomycin B (LMB) for 24 h showed accumulation of ANKHD1 inside the nucleus as compared to untreated cells where ANKHD1 was found to be predominantly in cytoplasm. This suggests ANKHD1 might be shuttling between cytoplasm and nucleus. In conclusion, ANKHD1 promotes MM growth by repressing p21 a potent cell cycle regulator.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O advento da terapia anti-retroviral de alta potência (HAART) alterou a história natural da aids, diminuindo sua mortalidade e a incidência de doenças oportunistas e aumentando a esperança de vida das pessoas vivendo com aids.Como uma doença crônica, outras questões passam a ser relevantes, entre elas a adesão ao tratamento, seus efeitos adversos e a qualidade de vida das pessoas nessa condição. A CIF constitui um instrumento adequado para identificar as características da funcionalidade, do ambiente e condições pessoais que interferem na qualidade de vida. Instrumentos para a sua aplicação, core sets, têm sido desenvolvidos para várias condições de saúde. Com o objetivo de propor um core set para aids, foram desenvolvidas duas etapas preliminares do modelo proposto para a construção desses instrumentos. A primeira etapa, de revisão sistemática buscou no MEDLINE artigos com descritores HAART e qualidade de vida, publicados em inglês, de 2000 a 2004. Foram selecionados 31 estudos que resultou em 87 conceitos dos quais 66 puderam ser identificados como categorias da CIF. Estas formaram as perguntas da entrevista aplicada em 42 voluntários, pacientes de um centro de referência para DST e Aids de São Paulo. Entre as condições mais freqüentemente associadas ao tratamento, estão às mudanças na imagem corporal, conseqüência da lipodistrofia, apontada em 84 por cento dos estudos e em 93 por cento das entrevistas. Alterações das funções digestivas, das relações íntimas, e das funções sexuais foram condições importantes identificadas no estudo. As duas etapas definiram 40 categorias da CIF como proposta preliminar de um core set para pacientes com aids

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Dihydroorotate dehydrogenase (DHODH) catalyzes the oxidation of dihydroorotate to orotate during the fourth step of the de novo pyrimidine synthesis pathway. In rapidly proliferating mammalian cells, pyrimidine salvage pathway is insufficient to overcome deficiencies in that pathway for nucleotide synthesis. Moreover, as certain parasites lack salvage enzymes, relying solely on the de novo pathway, DHODH inhibition has turned out as an efficient way to block pyrimidine biosynthesis. Escherichia coli DHODH (EcDHODH) is a class 2 DHODH, found associated to cytosolic membranes through an N-terminal extension. We used electronic spin resonance (ESR) to study the interaction of EcDHODH with vesicles of 1,2-dioleoyl-sn-glycero-phosphatidylcholine/detergent. Changes in vesicle dynamic structure induced by the enzyme were monitored via spin labels located at different positions of phospholipid derivatives. Two-component ESR spectra are obtained for labels 5- and 1 0-phosphatidylcholine in presence of EcDHODH, whereas other probes show a single-component spectrum. The appearance of an additional spectral component with features related to fast-motion regime of the probe is attributed to the formation of a defect-like structure in the membrane hydrophobic region. This is probably the mechanism used by the protein to capture quinones used as electron acceptors during catalysis. The use of specific spectral simulation routines allows us to characterize the ESR spectra in terms of changes in polarity and mobility around the spin-labeled phospholipids. We believe this is the first report of direct evidences concerning the binding of class 2 DHODH to membrane systems.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction: Cerebral ischemia is an important cause of brain lesion in humans. The target in research has been the ischemic core or the penumbra zones; little attention has been given to areas outside the core or the penumbra but connected with the primary site of injury. Objective: Evaluate the laminar response of a subpopulation of gabaergic cells, those that are parvalbumin (PV) positive and the astrocytes through the expression of the glial transporter GLT1 on the contralateral cortex to an ischemic core. Methodology: For this purpose we used the medial cerebral artery occlusion model in rats. The artery was occluded for 90 minutes and the animals were sacrificed at 24 and 72 hours post-ischemia. The brains were removed, cut in a vibratome at 50 microns and incubated with the primary antibodies against PV or GLT1. Sections were developed using the vectastain Kit. In control tissue the primary antibody was omitted. Results: When compared with control animals, treated ones show a decrease in the expression of GLT1, especially in layers III and IV of the contralateral cortex to the ischemic core. PV positive cells increases in layers II and V. Conclusion: Increases in the expression of PV cells could correspond to an adaptation associated with glutamate increases in the synaptic compartment. These increases may be due to decreases in the expression of GLT1 transporter, that could not remove the glutamate present in the synaptic cleft, generating hyperactivity in the contralateral cortex. These changes could represent an example of neuronal and glial plasticity in remote areas to an ischemic core but connected to the primary site of injury.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Magnetization and Mossbauer spectroscopy measurements are performed at low temperature under high field, on nanoparticles with a nickel ferrite core and a maghemite shell. These nanoparticles present finite size and surface effects, together with exchange anisotropy. High field magnetization brings the evidences of a monodomain ordered core and surface spins freezing in disorder at low temperature. Mossbauer spectra at 4.2 K present an extra contribution from the disordered surface which is field dependent. Field and size dependences of this latter show a progressive spin alignment along the ferrite core which is size dependent. The weak surface pinning condition of the nanoparticles confirms that the spin disorder is localized in the external shell. The underfield decrease in the mean canting angle in the superficial shell is then directly related to the unidirectional exchange anisotropy through the interface between the ordered core and the disordered shell. The obtained anisotropy field H(Ea) scales as the inverse of the nanoparticle diameter, validating its interfacial origin. The associated anisotropy constant K(Ea) equals 2.5 x 10(-4) J/m(2). (C) 2009 American Institute qf Physics. [doi: 10.1063/1.3245326]

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Positional information in developing embryos is specified by spatial gradients of transcriptional regulators. One of the classic systems for studying this is the activation of the hunchback (hb) gene in early fruit fly (Drosophila) segmentation by the maternally-derived gradient of the Bicoid (Bcd) protein. Gene regulation is subject to intrinsic noise which can produce variable expression. This variability must be constrained in the highly reproducible and coordinated events of development. We identify means by which noise is controlled during gene expression by characterizing the dependence of hb mRNA and protein output noise on hb promoter structure and transcriptional dynamics. We use a stochastic model of the hb promoter in which the number and strength of Bcd and Hb (self-regulatory) binding sites can be varied. Model parameters are fit to data from WT embryos, the self-regulation mutant hb(14F), and lacZ reporter constructs using different portions of the hb promoter. We have corroborated model noise predictions experimentally. The results indicate that WT (self-regulatory) Hb output noise is predominantly dependent on the transcription and translation dynamics of its own expression, rather than on Bcd fluctuations. The constructs and mutant, which lack self-regulation, indicate that the multiple Bcd binding sites in the hb promoter (and their strengths) also play a role in buffering noise. The model is robust to the variation in Bcd binding site number across a number of fly species. This study identifies particular ways in which promoter structure and regulatory dynamics reduce hb output noise. Insofar as many of these are common features of genes (e. g. multiple regulatory sites, cooperativity, self-feedback), the current results contribute to the general understanding of the reproducibility and determinacy of spatial patterning in early development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The structural and optical properties of GaAsP/GaP core-shell nanowires grown by gas source molecular beam epitaxy were investigated by transmission electron microscopy, Raman spectroscopy, photoluminescence (PL), and magneto-PL. The effects of surface depletion and compositional variations in the ternary alloy manifested as a redshift in GaAsP PL upon surface passivation, and a decrease in redshift in PL in the presence of a magnetic field due to spatial confinement of carriers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A recently developed thermal lens spectrometry configuration has been used to study CdSe/ZnS core-shell quantum dots (QDs) suspended in toluene and tetrahydrofuran (THF) solvents. The special features of this configuration make it very attractive to measure fluorescence quantum yield (eta) excitation spectrum since it simplifies the measurement procedure and consequently improve the accuracy. Furthermore, the precision reached is much higher than in conventional photoluminescence (PL) technique. Two methods, called reference sample and multiwavelength have been applied to determine eta, varying excitation wavelength in the UV-visible region (between 335-543 nm). The eta and PL spectra are practically independent of the excitation wavelength. For CdSe/ZnS QDs suspended in toluene we have obtained eta=76 +/- 2%. In addition, the aging effect on eta and PL has been studied over a 200 h period for QDs suspended in THF. (C) 2010 American Institute of Physics. [doi:10.1063/1.3343517]