1000 resultados para COCHLIOMYIA-HOMINIVORAX DIPTERA
Resumo:
To quantify the potential capability of transporting and passing infective pathogens of some blowflies (Diptera: Calliphoridae), Mihályi's danger-index was calculated for seven species. The original equation was modified to include synanthropic information to discriminate between asynanthropic, hemisynanthropic, and eusynanthropic status. Three groups were recognized, of which Phaenicia cluvia and Musca domestica proved the flies with lowest index value (D = 2.93 and 3.00 respectively); Cochliomyia macellaria, Chrysomya albiceps and Sarconesia chlorogaster presented a significantly higher index value (p < 0.10; D = 4.28, 4.44 and 5.66 respectively) and C. megacephala, C. vicina and P. sericata appear to represent the heaviest potential sanitary risk with the highest index value (p < 0.10; D = 15.54, 16.88 and 12.49 respectively).
Resumo:
Optimal foraging theory assumes that predators use different prey types to maximize their rate of energetic gain. Studies focusing on prey preference are important sources of information to understand the foraging dynamics of Chrysomya albiceps. The purpose of this investigation is to determine the influence of larval starvation in C. albiceps on the predation rate of different prey blowfly species and instars under laboratory conditions. Our results suggest that C. albiceps prefers Cochliomyia macellaria larvae to Chrysomya megacephala under non-starvation and starvation conditions. Nevertheless, predators gained more weight consuming C. macellaria. This result suggests that C. albiceps profit more in consuming C. macellaria rather than C. megacephala. The foraging behaviour displayed by C. abiceps on their prey and the consequences for the blowfly community are also discussed.
Resumo:
The sensitivity of parameters that govern the stability of population size in Chrysomya albiceps and describe its spatial dynamics was evaluated in this study. The dynamics was modeled using a density-dependent model of population growth. Our simulations show that variation in fecundity and mainly in survival has marked effect on the dynamics and indicates the possibility of transitions from one-point equilibrium to bounded oscillations. C. albiceps exhibits a two-point limit cycle, but the introduction of diffusive dispersal induces an evident qualitative shift from two-point limit cycle to a one fixed-point dynamics. Population dynamics of C. albiceps is here compared to dynamics of Cochliomyia macellaria, C. megacephala and C. putoria.
Resumo:
The equilibrium dynamics of native and introduced blowflies is modelled using a density-dependent model of population growth that takes into account important features of the life-history in these flies. A theoretical analysis indicates that the product of maximum fecundity and survival is the primary determinant of the dynamics. Cochliomyia macellaria, a blowfly native to the Americas and the introduced Chrysomya megacephala and Chrysomya putoria, differ in their dynamics in that the first species shows a damping oscillatory behavior leading to a one-point equilibrium, whereas in the last two species population numbers show a two-point limit cycle. Simulations showed that variation in fecundity has a marked effect on the dynamics and indicates the possibility of transitions from one-point equilibrium to bounded oscillations and aperiodic behavior. Variation in survival has much less influence on the dynamics.
Resumo:
Equilibrium dynamics in experimental populations of Chrysomya megacephala (F.) and C. putoria (Wiedemann), which have recently invaded the Americas, and the native species Cochliomyia macellaria (F.), were investigated using nonlinear difference equations. A theoretical analysis of the mathematical model using bifurcation theory established the combination of demographic parameters responsible for producing shifts in blowfly population dynamics from stable equilibria to bounded cycles and aperiodic behavior. Mathematical modeling shows that the populations of the 2 introduced Chrysomya species will form stable oscillations with numbers fluctuating 3-4 times in successive generations. However, in the native species C. macellaria, the dynamics is characterized by damping oscillations in population size, leading to a stable population level.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Chrysomya albiceps, the larvae of which are facultative predators of larvae of other dipteran species, has been introduced to the Americas over recent years along with other Old World species of blowflies, including Chrysomya megacephala, Chrysomya putoria and Chlysomya rufifacies. An apparent correlate of this biological invasion has been a sudden decline in the population numbers of Cochliomyia macellaria, a native species of the Americas. In this study, we investigated predation rates on third instar larvae of C. macellaria, C. putoria and C. megacephala by third instar larvae of C. albiceps in no-choice, two-choice and three-choice situations. Most attacks by C. albiceps larvae occurred within the first hour of observation and the highest predation rate occurred on C. macellaria larvae, suggesting that C. albiceps was more dangerous to C. macellaria than to C. megacephala and C. putoria under these experimental conditions. The rates of larvae killed as a result of the predation, as well as its implications to population dynamics of introduced and native species are discussed.
Resumo:
O presente estudo teve como objetivo conhecer a fauna e o padrão de distribuição temporal de califorídeos que colonizam cadáveres suínos em uma área de cerrado na Reserva Ecológica do Inhamum (REI), Caxias, MA. Foram realizados dois experimentos, um no período seco (julho a agosto/2010) e o outro no período chuvoso (março a abril/2011). Em cada experimento foram utilizados três suínos de 12 kg cada, colocados em gaiola de metal. Sobre cada gaiola foi colocada uma “armadilha do tipo suspensa” para capturar os califorídeos adultos que visitassem os cadáveres suínos. Bandejas com serragem foram acopladas debaixo das gaiolas, para coleta de imaturos. Foram obtidos 51.234 espécimes de califorídeos, sendo 25.093 de adultos coletados e 26.141 de adultos criados. Foram identificadas as seguintes espécies: Chloroprocta idioidea (Robineau-Desvoidy, 1830) Chrysomya albiceps (Wiedemann, 1819), Chrysomya megacephala (Fabricius, 1794), Chrysomya rufifacies (Macquart, 1843), Cochliomyia macellaria (Fabricius, 1775), Hemilucilia benoisti Séguy, 1925, Hemilucilia segmentaria (Fabricius, 1805), Hemilucilia townsendi Shannon, 1926, Lucilia eximia (Wiedemann, 1818) e Lucilia sp1. Chrysomya rufifacies e H. townsendi são novos registros para o Brasil. Cochliomyia macellaria e C. idioidea foram as mais abundantes, em relação aos adultos coletados, enquanto que C. albiceps e C. rufifacies foram as mais abundantes entre os adultos criados. Apenas as espécies do gênero Hemilucilia não se criaram nos cadáveres suínos. A duração da decomposição dos cadáveres suínos foi, em média, de 10 dias e não variou entre os perídos seco e chuvoso, assim como a duração de cada estágio também foi semelhante entre os períodos. As durações dos estágios de decomposição foram diferentes entre si, sendo que o estágio de fermentação foi o mais duradouro. As espécies adultas coletadas de L. eximia, C. idioidea e C. macellaria foram pioneiras na colonização dos cadáveres suínos e estiveram presentes em todos os estágios de decomposição, mas somente L. eximia apresentou associação com o estágio Inicial, segundo o índice de IndVal. Os imaturos de L. eximia foram os primeiros a abandonarem os cadáveres para empuparem no solo, seguidos pelos imaturos de C. macellaria, C. albiceps e C. rufifacies. Segundo o índice de IndVal, os adultos coletados das espécies H. townsendi e H. benoisti foram as únicas que apresentaram associação a apenas um estágio, o de Inchamento; C. rufifacies e C. megacephala apresentaram associação aos estágios de Putrefação Escura e Fermentação; e as demais espécies apresentaram associação a quatro estágios. Em relação aos adultos criados, L. eximia e C. macellaria foram as únicas que apresentaram associação ao estágio de Inchamento, enquanto que C. albiceps e C. rufifacies, as únicas que apresentaram associação ao estágio seco. Os valores de abundância das espécies adultas coletadas de L. eximia, C. idioidea, C. macellaria, C. albiceps e C. rufifacies diferiram entre os estágios de decomposição, sendo que, o de Putrefação Escura foi o mais atrativo. Os valores de abundância dos adultos criados de C. albiceps, C. rufifacies e L. eximia também diferiram entre os estágios, sendo que, o estágio seco foi onde ocorreu maior abundância das espécies de Chrysomya e o de Putrefação Escura, o de L. eximia. Os adultos coletados de L. eximia e C. idioidea, e os adultos criados de C. rufifacies foram mais abundantes no período chuvoso. Em relação aos adultos coletados, a análise de ordenação demonstrou que as comunidades de califorídeos apresentaram maior semelhança entre os estágios de Putrefação Escura, Fermentação e Seco, devido aos maiores valores de riqueza e abundância; no entanto, em relação aos adultos criados, as comunidades dos estágios de Fermentação e Seco foram as mais semelhantes. Estes resultados contribuem para o entendimento do processo de sucessão das espécies de califorídeos adultos visitantes e criados durante a decomposição de cadáveres suínos em uma área de cerrado do estado do Maranhão.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.
Resumo:
Species identification is an essential step in the progress and completion of work in several areas of biological knowledge, but it is not a simple process. Due to the close phylogenetic relationship of certain species, morphological characters are not always sufficiently distinguishable. As a result, it is necessary to combine several methods of analysis that contribute to a distinct categorization of taxa. This study aimed to raise diagnostic characters, both morphological and molecular, for the correct identification of species of the genus Chrysomya (Diptera: Calliphoridae) recorded in the New World, which has continuously generated discussion about its taxonomic position over the last century. A clear example of this situation was the first record of Chrysomya rufifacies in Brazilian territory in 2012. However, the morphological polymorphism and genetic variability of Chrysomya albiceps studied here show that both species (C. rufifacies and C. albiceps) share very similar character states, leading to misidentification and subsequent registration error of species present in our territory. This conclusion is demonstrated by the authors, based on a review of the material deposited in major scientific collections in Brazil and subsequent molecular and phylogenetic analysis of these samples. Additionally, we have proposed a new taxonomic key to separate the species of Chrysomya found on the American continent, taking into account a larger number of characters beyond those available in current literature.
Resumo:
In insects that utilize patchy and ephemeral resources for feeding and egg laying, the outcome of larval competition for food resources depends on the amount of resources and the spatial distribution of immatures among patches of food. In the present study, the results of larval competition for food in Chrysomya megacephala, in traits such as female weight, fecundity and reproductive investment, were different in situations where the level of larval aggregation (proportion of competitors per amount of food) was the same, but with densities of competitors and amounts of food proportionally different. These results are indicative that the larval competition may depend both on the larval density and the amount of food, in different situations with the same proportion of larvae per gram of food.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.
Resumo:
Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity.