909 resultados para Competitive PCR
Resumo:
To investigate microbial diversity and identify spoilage bacteria in fresh pork sausages during storage, twelve industrial pork sausages of different trademarks were stored at 4 ºC for 0, 14, 28 and 42 days, 80% relative humidity and packaged in sterile plastic bags. Microbiological analysis was performed. The pH and water activity (a w) were measured. The culture-independent method performed was the Polymerase Chain Reaction - Denaturing Gradient Gel Electrophoresis (PCR-DGGE). The culture-dependent method showed that the populations of mesophilic bacteria and Lactic Acid Bacteria (LAB) increased linearly over storage time. At the end of the storage time, the average population of microorganisms was detected, in general, at the level of 5 log cfu g-1. A significant (P < 0.005) increase was observed in pH and a w values at the end of the storage time. The PCR-DGGE allowed a rapid identification of dominant communities present in sausages. PCR-DGGE discriminated 15 species and seven genera of bacteria that frequently constitute the microbiota in sausage products. The most frequent spoilage bacteria identified in the sausages were Lactobacillus sakei and Brochothrix thermosphacta. The identification of dominant communities present in fresh pork sausages can help in the choice of the most effective preservation method for extending the product shelf-life.
Resumo:
The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.
Resumo:
E-commerce is one of the most fast growing business areas today and an extremely important channel in retail. In order for companies to succeed in this business environment, it is highly important to understand consumers and how they perceive and select webstores. The objective of the study is to investigate how to achieve competitive e-commerce by investigating consumers and the factors based on which they select a webstore. In addition, the study also seeks to explore whether sex or consumers’ buying experience have an effect on consumer’s webstore selection. Managerial implications are viewed from case company’s perspective. In order to answer the research questions a quantitative marketing survey was conducted. The data was collected by online questionnaire using the case company’s customers as respondents. A total of 1613 responses were obtained from Finnish consumers. Responses were analyzed using ANOVA, factor analysis and t-test. The results show that the most important factors in consumer’s webstore selection are usability, reliability and vendor related information. The biggest difference between heavy and light shoppers is trust formation. Light shoppers value physical stores and familiar vendors, whereas heavy shoppers judge vendor based on the information and usability. Women perceive higher risk than men. The winning strategy requires a hybrid of cost leadership and differentiation.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Partial ownership interests are a widespread phenomenon in modern corporate environment. Unless minority shareholding affords the target to exercise control over the target, they do currently not have to be notified to the European Commission under EU merger regime. However, economic research has long suggested that when linking competing or non-horizontally positioned undertakings particularly in industries with few competitors, minority shareholdings even far below the majority of shares or voting rights could lead to higher prices or lower output volumes to the detriment of consumers. The Commission has recognized this issue and proceeded to suggest an extension of the merger regime to catch also certain non-controlling minority acquisitions. Horizontal non-controlling minority shareholdings create a positive correlation between the sales revenues of the partial acquirer and target. Through the equity interest the acquirer will internalise a fraction, proportional to the financial rights attached to the shareholding, of the profit of the target. This will incentivise the acquirer to contribute to increasing the target’s business profits by increasing its own sales price (horizontal unilateral effects). When a minority stake is held in a vertically related or a conglomerate company, the minority acquirer could be allowed to hamper or eliminate the target’s rivals’ access either to inputs (input foreclosure) or customers (customer foreclosure), depending on which level of the supply chain the parties are (vertical unilateral effects). Under certain circumstances minority share acquisitions could also lessen competition because they facilitate collusion between companies active in the market (coordinated effects). Economic theory confirms that non-controlling minority shareholdings may under certain circumstances create anti-competitive effects that are unlikely to be remedies by pro-competitive effects. However, they are likely to be of less significant nature than anticompetitive effects created by full mergers. This derives fore mostly from the fact that a minority share acquirer carries all the costs associated with its unilateral action but will internalise only a fraction of the lost profits. This is likely to limit the acquirer’s incentive to raise price and the profitability of such behavior. Having in mind that the number of potentially problematic cases is expected to be next to negligible, the limited potential competitive effects of non-controlling minority share acquisitions cannot be seen to clearly merit extension of the scope of the EUMR. The system suggested by the Commission is particularly ill-fitted for such purpose given the clear lack of legal certainty and considerable administrative burden associated with it.
Resumo:
Maize seeds, infected by Stenocarpella species, are important sources of inoculum for the introduction and dissemination of stalk and ear rot and macrospore leaf spot diseases. The use of healthy seeds is an important strategy for the preventive control of these diseases. However, one of the difficulties in the health quality control programs for maize seeds is the availability of a reliable and quick method for detecting these fungi during routine seed analyses. Therefore, the objective of the present study was to investigate the possibility of using the PCR technique as an alternative method for accurately detecting these pathogens in maize seed samples. Maize seeds were kept in contact with S. maydis colonie developed in PDA media containing mannitol at -1.4 MPa for 72 h. The seed samples used in this study were prepared with infected seeds at incidences of 100, 20, 10, 2, 1 and zero %.The primers used were able to detect S. maydis fungi in association with seeds with a maximum of 2% , however those primers were not able to differentiate between the two species.
Resumo:
Biorefineries is a perspective field of study that covers many opportunities of a successful business unit with respect to sustainability. The thesis focuses on the following key objective: identification of a competitive biorefineries production process in small and medium segments of the chemical and forest industries in Finland. The scope of the research relates to the selected biorefineries operations in Finland and the use of hemicellulose, as a raw material. The identification of the types of biorefineries and the important technical and process characteristics opens the advantage in the company’s competitive analysis. The study concentrates on the practical approach to the scientific methods of the market and companies research with the help of Quality Function Deployment and House of Quality tool. The thesis’s findings provide mindset version of the expert’s House of Quality application, identification of crucial biorefineries technical and design characteristics’ correlation and their effect on the competitive behavior of a company. The theoretical background helps to build the picture of the problematic issues within the field and provides scientific possible solutions. The analysis of the biorefineries’ market and companies operations bring the practical-oriented aptitude of the research. The results of the research can be used for the following investigations in a field and may be applied as a company’s management analytic and strategic application.
Resumo:
The purpose of this research was to study the marketing of mobile applications. The main objective was to find out what are the most efficient ways of marketing to increase the sales for a mobile application within a highly competitive marketplace. The marketplaces, app stores, are studied from the perspective of size, ease of entry, competition and customers and their purchasing process. The study also includes research on what are some of the main marketing methods used in mobile app marketing in general. The study consists of two parts, theoretical and empirical research. Theoretical research was done by studying past scientific research on the chosen subjects. As the subject is very new, the research was also extended to other publications from the field of mobile technology. The empirical part was done through interviews and empirical experiments with a case-company, which were used to answer the main objective of this study. These experiments showed that the chosen methods of mobile app marketing, app store optimization, localization and selected social media marketing activities, created the most sales when used together. Positive results were seen also when the activities were conducted by themselves, but together they were able to push the case company to their all time best results. However the key to succeeding and hitting high positions in the app store rankings would most likely require creating a solid marketing strategy, trying out other marketing activities alongside the ones used here, without forgetting to stay on top of mobile technology trends.
Resumo:
Kvantitatiivinen reaaliaikainen polymeraasiketjureaktio (engl. polymerase chain reaction, PCR) on osoittautunut käyttäjäystävällisimmäksi menetelmäksi nukleiinihapposekvenssien kvantitoimisessa. Tätä menetelmää voidaan herkistää pienempien DNA-pitoisuuksien havaitsemiseen käyttämällä hyväksi aikaerotteista fluorometriaa (engl. time-resolved fluorometry, TRF) ja luminoivia lantanidileimoja, joiden fluoresenssin pitkän eliniän ansiosta emission mittaus voidaan suorittaa vasta hetki virittävän valopulssin jälkeen, jolloin lyhytikäinen taustasäteily ehtii sammua. Tuloksena saadaan korkea signaali-taustasuhde. Tämän diplomityön tarkoituksena oli rakentaa TRF:än pystyvä reaaliaikainen PCR-laite, sillä tällaista laitetta ei ole markkinoilla tarjolla. Laite rakennettiin kehittämällä lämpökierrätin ja yhdistämällä se valmiiseen TRF:än kykenevään mittapäähän. Mittapään ja lämpökierrättimen hallitsemiseksi kehitettiin myös tietokoneohjelma. Valon tuottamiseksi ja mittaamiseksi haluttiin käyttää edullisia komponentteja, joten työssä käytettiin valmiin mittapään optiikkaa, jossa viritys tapahtuu hohtodiodilla (engl. light-emitting diode, LED) ja lantanidileiman emission mittaus fotodiodilla (engl. photodiode, PD) tai valomonistinputkella (engl. photomultiplier tube, PMT). Myös mittapään suorituskykyä tutkittiin. Työtä varten kehitettiin lämpökierrätin, joka koostui Peltier-elementillä lämmitettävästä PCR-putkitelineestä ja lämpökannesta. Mittalaitteen suorituskyvyn tutkimiseen käytettiin kelaattikomplementaatioon perustuvaa PCR-tuotteen havaitsemismenetelmää. Kelaattikomplementaatio perustuu kahteen erilliseen oligonukleotidimolekyyliin, joista toiseen on sidottu lantanidi-ioni ja toiseen valoa absorboiva ligandirakenne, jotka yhdessä muodostavat fluoresoivan kokonaisuuden. Kehitetyn lämpökierrättimen todettiin olevan tarpeeksi tarkka sekä tehokas ja sen lämmitys- ja jäähdytysnopeuden maksimeiksi saatiin 2,6 °C/sekunti. Detektorina käytetyn PD:n ei todettu olevan tarpeeksi herkkä emission havainnoimiseksi ja se korvattiin laitteessa PMT:llä. Käytetyllä PCR-määrityksellä kynnyssykleiksi (engl. threshold cycle, Ct) sekä kehitetylle että referenssilaitteelle saatiin 28,4 käyttämällä samaa 100 000 kopion DNA:n aloitusmäärää. Työssä osoitettiin, että on mahdollista kehittää edullisia komponentteja käyttävä, TRF:än pystyvä, reaaliaikainen PCR-laite, joka kykenee vastaavaan Ct-arvoon kuin vertailulaite. PD:n herkkyys ei kuitenkaan riittänyt. Tulokset olivat lupaavia, sillä LED- ja PD-teknologiat kehittyvät ja markkinoille on tullut myös muita komponentteja, joiden avulla on tulevaisuudessa mahdollista kehittää vielä herkempi laite.
Resumo:
Competitividad y valor compartido
Resumo:
Fire blight is an economically important disease of apples and pears that is caused by the
bacterium Erwinia amylovora. Control of the disease depends on limiting primaly blosson1
infection in the spring, and rapidly removing infected tissue. The possibility of using phages to
control E.amylovora populations has been suggested, but previous studies have. failed to show
high treatment efficacies. This work describes the development of a phage-based biopesticide
that controls E. amylovora populations under field conditions, and significantly reduces the
incidence of fire blight.
This work reports the first use ofPantoea agglomerans, a non-pathogenic relative ofE.
amylovora, as a carrier for E. amylovora.phages. Its role is to support a replicating population of
these phages on blossom surfaces during the period when the flowers are most susceptible to
infection. Seven phages and one carrier isolate were selected for field trials from existing
collections of 56 E. amylovora phages and 249 epiphytic orchard bacteria. Selection of the .
/'
phages and carrier was based on characteristics relevant to the production and field perfonnance
of a biopesticide: host range, genetic diversity, growth under the conditions of large-scale
production, and the ability to prevent E. amylovora from infecting pear blossoms. In planta
assays showed that both the phages and the carrier make significant contributions to reducirig the
development of fire blight symptoms in pear blossoms.
Field-scale phage production and purification methods were developed based on the
growth characteristics of the phages and bacteria in liquid culture, and on the survival of phages
in various liquid media.
Six of twelve phage-carrier biopesticide treatments caused statistically signiflcant reductions in disease incidence during orchard trials. Multiplex real-time PCR was used to
simultaneously monitor the phage, carrier, and pathogen populations over the course of selected
treatments. In all cases. the observed population dynamics of the biocontrol agents and the
pathogen were consistent with the success or failure of each treatment to control disease
incidence. In treatments exhibiting a significantly reduced incidel1ce of fire blight, the average
blossom population ofE.amylovora had been reduced to pre-experiment epiphytic levels. In
successful treatments the phages grew on the P. agglomerans carrier for 2 to 3 d after treatment
application. The phages then grew preferentially on the pathogen, once it was introduced into this
blossom ecosystem. The efficacy of the successful phage-based treatnlents was statistically
similar to that of streptomycin, which is the most effective bactericide currently available for fire
blight prevention.
The in planta behaviour ofE. amylovora was compared to that ofErwinia pyrifoliae, a
closely related species that causes fire blight-like synlptoms on pears in southeast Asia. Duplex
real-time PCR was used to monitor the population dynamics of both species on single blossonls.
E. amylovora exhibited a greater competitive fitness on Bartlett pear blossoms than E. pyrifoliae.
The genome ofErwinia phage
Resumo:
The purpose of this study was to examine processes and interactions that characterized positive developmental experiences in sport. A highly competitive and reputable U-17 girls' soccer team was chosen for the study through purposeful sampling, providing an information rich case from which data could be derived (Patton, 2002). Seventeen players and three coaches participated in this study. Based on an ethnographic methodology data were collected via observations and both informal and formal semi-structured interviews. Tlie data were coded according to the three procedures outlined by Seidel and Kelle (1995): a) noticing relevant phenomena, b) collecting examples of those phenomena, and c) analyzing those phenomena in order to find commonalities, differences, patterns and structures. Significant events and underlying themes were recounted chronologically through a collection of vignettes, aimed to provide a contextual lens for the reader. Results revolved around two prominent themes: Teamwork and leadership. These were closely related concepts that required players to demonstrate a wide range of developmental skills for the team to move collectively towards their end goal. Furthermore, teamwork and leadership experiences took both desirable and undesirable forms. For example, at the beginning of the season competition existed amongst the players at the expense of teamwork and leadership. As the season progressed the pursuit of a shared goal allowed the players to view each other as collaborators and teamwork and leadership skills became increasingly evident. At times, however, success on the field was prioritized above maintaining relationships off the field, requiring the coaches to intervene and re-establish equilibrium.