Molecular diagnosis of Huntington disease in Brazilian patients

Huntington disease (HD) is a progressive neurodegenerative disorder with autosomal dominant inheritance, characterized by choreiform movements and cognitive impairment. Onset of symptoms is around 40 years of age and progression to death occurs in approximately 10 to 15 years from the time of disease onset. HD is associated with an unstable CAG repeat expansion at the 5' and of the IT15 gene. We have genotyped the CAG repeat in the IT15 gene in 44 Brazilian individuals (42 patients and 2 unaffected family members) belonging to 34 unrelated families thought to segregate HD. We found one expanded CAG allele in 32 individuals (76%) belonging to 25 unrelated families. In these HD patients, expanded alleles varied from 43 to 73 CAG units and normal alleles varied from 18 to 26 CAGs. A significant negative correlation between age at onset of symptoms and size of the expanded CAG allele was found (r=0.6; p=0.0001); however, the size of the expanded CAG repeat could explain only about 40% of the variability in age at onset (r2=0.4). In addition, we genotyped 25 unrelated control individuals (total of 50 alleles) and found normal CAG repeats varying from 16 to 33 units. The percentage of heterozigocity of the normal allele in the control population was 88%. In conclusion, our results showed that not all patients with the HD phenotype carried the expansion at the IT15 gene. Furthermore, molecular diagnosis was possible in all individuals, since no alleles of intermediate size were found. Therefore, molecular confirmation of the clinical diagnosis in HD should be sought in all suspected patients, making it possible for adequate genetic counseling.

The G209A mutation in the alpha-synuclein gene in Brazilian families with Parkinson's disease

A missense G209A mutation of the alpha-synuclein gene was recently described in a large Contursi kindred with Parkinson's disease (PD). The objective of this study is to determine if the mutation G209A of the alpha-synuclein gene was present in 10 Brazilian families with PD. PD patients were recruited from movement disorders clinics of Brazil. A family history with two or more affected in relatives was the inclusion criterion for this study. The alpha-synuclein G209A mutation assay was made using polymerase chain reaction and the restriction enzyme Tsp45I. Ten patients from 10 unrelated families were studied. The mean age of PD onset was 42.7 years old. We did not find the G209A mutation in our 10 families with PD. Our results suggest that alpha-synuclein mutation G209A is uncommon in Brazilian PD families.

Machado-Joseph disease versus hereditary spastic paraplegia: case report

Machado-Joseph disease (MJD) is the most common autosomal dominant spinocerebellar ataxia and presents great phenotypic variability. MJD presenting with spastic paraparesis was recently described in Japanese patients. We report the case of 41-year-old woman with the phenotype of complicated hereditary spastic paraplegia. Her father died at the age of 56 years due to an undiagnosed progressive neurological disease that presented parkinsonism. She had an expanded allele with 66 CAG repeats and a normal allele with 22 repeats in the gene of MJD. MJD should be considered in the differential diagnosis of autosomal dominant complicated HSP. A patient with the phenotype of complicated HSP and relatives with other clinical features of a neurodegenerative disease should raise the suspicion of MJD.

Whipple's disease with neurological manifestions: case report

Whipple's disease (WD) is an uncommon multisystem condition caused by the bacillus Tropheryma whipplei. Central nervous system involvement is a classical feature of the disease observed in 20 to 40% of the patients. We report the case of a 62 yeards old man with WD that developed neurological manifestations during its course, and discuss the most usual signs and symptoms focusing on recent diagnostic criteria and novel treatment regimens.

Two mistletoes are too many?: Interspecific occurrence of mistletoes on the same host tree

Mistletoe can have a major impact on the fitness of the host plant. If there is more than one species of mistletoe on the same host tree, the overall impact might be amplified. We report the occurrence of more than one species of mistletoe on the same host tree. Although it is not a rule in the field, to our knowledge, there have been no studies of this topic. In most cases, two species of mistletoe were recorded on the same host tree, although we recorded three species of mistletoe on one occasion. This demonstrates that different species of mistletoe can be compatible with the same host species. Therefore, compatibility (structural and physiological) might be an important factor for the occurrence of mistletoe. Recent studies have shown that if the mistletoe does not recognize the host species, the deposited seeds will germinate but the haustorium will not penetrate the host branch. This is probably the primary mechanism in the establishment of more than one species of mistletoe on the same host, which can trigger a cascade of harmful effects for the host species.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Thyroid nodules and differentiated thyroid cancer: update on the Brazilian consensus

Thyroid nodules are frequent findings, especially when sensitive imaging methods are used. Although thyroid cancer is relatively rare, its incidence is increasing, particularly in terms of small tumors, which have an uncertain clinical relevance. Most patients with differentiated thyroid cancer exhibit satisfactory clinical outcomes when treatment is appropriate, and their mortality rate is similar to that of the overall population. However, relapse occurs in a considerable fraction of these patients, and some patients stop responding to conventional treatment and eventually die from their disease. Therefore, the challenge is how to identify the individuals who require more aggressive disease management while sparing the majority of patients from unnecessary treatments and procedures. We have updated the Brazilian Consensus that was published in 2007, emphasizing the diagnostic and therapeutic advances that the participants, representing several Brazilian university centers, consider most relevant in clinical practice. The formulation of the present guidelines was based on the participants' experience and a review of the relevant literature.

Dry eye disease caused by viral infection: review

Dry eye disease and ocular surface disorders may be caused or worsened by viral agents. There are several known and suspected virus associated to ocular surface diseases. The possible pathogenic mechanisms for virus-related dry eye disease are presented herein. This review serves to reinforce the importance of ophthalmologists as one of the healthcare professional able to diagnose a potentially large number of infected patients with high prevalent viral agents.

Knowledge and attitude of parents or caretakers regarding transmissibility os caries disease

Dental caries is a transmissible infectious disease in which mutans streptococci are generally considered to be the main etiological agents. Although the transmissibility of dental caries is relatively well established in the literature, little is known whether information regarding this issue is correctly provided to the population. The present study aimed at evaluating, by means of a questionnaire, the knowledge and usual attitude of 640 parents and caretakers regarding the transmissibility of caries disease. Most interviewed adults did not know the concept of dental caries being an infectious and transmissible disease, and reported the habit of blowing and tasting food, sharing utensils and kissing the children on their mouth. 372 (58.1%) adults reported that their children had already been seen by a dentist, 264 (41.3%) answered that their children had never gone to a dentist, and 4 (0.6%) did not know. When the adults were asked whether their children had already had dental caries, 107 (16.7%) answered yes, 489 (76.4%) answered no, and 44 (6.9%) did not know. Taken together, these data reinforce the need to provide the population with some important information regarding the transmission of dental caries in order to facilitate a more comprehensive approach towards the prevention of the disease.

Short-Term effect of COX-2 selective inhibitor as an adjunct for the treatment of periodontal disease: a clinical double-blind study in humans

Adjunctive therapeutic strategies that modulate the inflammatory mediators can play a significant role in periodontal therapy. In this double-blind, placebo-controlled study, 60 subjects diagnosed as periodontitis patients were evaluated for 28 days after periodontal treatment combined with selective cyclooxygenase-2 (COX-2) inhibitor. The experimental group received scaling and root planning (SRP) combined with the Loxoprofen antiinflammatory drug (SRP+Loxoprofen). The control group received SRP combined with placebo (SRP+placebo). Plaque index (PI), probing pocket depth (PD) and bleeding on probing (BOP) were monitored with an electronic probe at baseline and after 14 and 28 days. Both groups displayed clinical improvement in PD, PI and BOP. They also showed statistically similar values (p>0.05) of PD reduction on day 14 (0.4 mm) and on day 28 (0.6 mm). At the baseline, few deeper sites (>7 mm) from SRP+Loxoprofen group were responsible and most PD reduction was observed after 14 days (p<0.05). The percentage of remaining deep pockets (>7 mm) after 14 days in the SRP+Loxoprofen group was significantly lower (p<0.05) than in the SRP+placebo group. Loxoprofen presents potential effect as an adjunct of periodontal disease treatment, but long-term clinical trials are necessary to confirm its efficacy.

Lesion of the subthalamic nucleus reverses motor deficits but not death of nigrostriatal dopaminergic neurons in a rat 6-hydroxydopamine-lesion model of Parkinson's disease

The objective of the present study was to determine whether lesion of the subthalamic nucleus (STN) promoted by N-methyl-D-aspartate (NMDA) would rescue nigrostriatal dopaminergic neurons after unilateral 6-hydroxydopamine (6-OHDA) injection into the medial forebrain bundle (MFB). Initially, 16 mg 6-OHDA (6-OHDA group) or vehicle (artificial cerebrospinal fluid - aCSF; Sham group) was infused into the right MFB of adult male Wistar rats. Fifteen days after surgery, the 6-OHDA and SHAM groups were randomly subdivided and received ipsilateral injection of either 60 mM NMDA or aCSF in the right STN. Additionally, a control group was not submitted to stereotaxic surgery. Five groups of rats were studied: 6-OHDA/NMDA, 6-OHDA/Sham, Sham/NMDA, Sham/Sham, and Control. Fourteen days after injection of 6-OHDA, rats were submitted to the rotational test induced by apomorphine (0.1 mg/kg, ip) and to the open-field test. The same tests were performed again 14 days after NMDA-induced lesion of the STN. The STN lesion reduced the contralateral turns induced by apomorphine and blocked the progression of motor impairment in the open-field test in 6-OHDA-treated rats. However, lesion of the STN did not prevent the reduction of striatal concentrations of dopamine and metabolites or the number of nigrostriatal dopaminergic neurons after 6-OHDA lesion. Therefore, STN lesion is able to reverse motor deficits after severe 6-OHDA-induced lesion of the nigrostriatal pathway, but does not protect or rescue dopaminergic neurons in the substantia nigra pars compacta.

A novel A2 allele found in Leishmania (Leishmania) infantum chagasi

Visceral leishmaniasis (VL) is a widely spread zoonotic disease. In Brazil the disease is caused by Leishmania (Leishmania) infantum chagasi. Peridomestic sandflies acquire the etiological agent by feeding on blood of infected reservoir animals, such as dogs or wildlife. The disease is endemic in Brazil and epidemic foci have been reported in densely populated cities all over the country. Many clinical features of Leishmania infection are related to the host-parasite relationship, and many candidate virulence factors in parasites that cause VL have been studied such as A2 genes. The A2 gene was first isolated in 1994 and then in 2005 three new alleles were described in Leishmania (Leishmania) infantum. In the present study we amplified by polymerase chain reaction (PCR) and sequenced the A2 gene from the genome of a clonal population of L. (L.) infantum chagasi VL parasites. The L. (L.) infantum chagasi A2 gene was amplified, cloned, and sequenced in. The amplified fragment showed approximately 90% similarity with another A2 allele amplified in Leishmania (Leishmania) donovani and in L.(L.) infantum described in literature. However, nucleotide translation shows differences in protein amino acid sequence, which may be essential to determine the variability of A2 genes in the species of the L. (L.) donovani complex and represents an additional tool to help understanding the role this gene family may have in establishing virulence and immunity in visceral leishmaniasis. This knowledge is important for the development of more accurate diagnostic tests and effective tools for disease control.

Influência da luminosidade e da camada de cera epicuticular de superfícies de folhas de soja na infecção de Phakopsora pachyrhizi

A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primeiro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies.

Protector mechanisms of the association between gastroesophageal reflux disease and asthma: experimental study in rats

BACKGROUND: It is well known the association between gastroesophageal reflux disease and asthma. The hyperreactivity of the airways is a characteristic of an asthmatic. Many studies associate the increase of the airways reactivity with gastroesophageal reflux disease. AIM: In this study we have evaluated the effect of the intraluminal exposition to gastric juice of trachea on the reactivity to methacholine from rats submitted to a pulmonary allergic inflammation. METHODS: Group of rats were sensitized and challenged with ovalbumin. After 24 hours the animals were sacrificed, and their tracheae were removed to be cultured with gastric juice. The gastric juice was obtained from a donor rat. Subsequently the segments were placed into plastic plates with RPMI-1640 for incubation, under suitable atmosphere and time. After the period of incubation the segments were put into chambers for the analysis of the contractile response to methacholine. RESULTS: We observed reduction in the contractile response of trachea cultured with gastric juice from allergic rats. This result was confirmed by the pharmacological treatments with compound 48/80 and dissodium cromoglicate (mast cells blockade), L-NAME (nitric oxide inhibitor, NO), capsaicin (neuropeptides depletion) and indomethacin (ciclooxigenase inhibitor). CONCLUSIONS: Our results highlight to the existence of a complex interaction between pulmonary allergy and gastric juice in the airways. The involvement of the non-adrenergic non-cholinergic system, NO, prostanoids and mast cells are directly related to this interaction. We suggest that the reduced contractile response observed in vitro may represent a protector mechanism of the airways. Despite its presence in the human body it can not be observed due to the predominant effects of excitatory the non-adrenergic non-cholinergic system.