All Green, But Equal? Morphological Traits And Ecological Implications On Spores Of Three Species Of Mosses In The Brazilian Atlantic Forest.

Spores of the tropical mosses Pyrrhobryum spiniforme, Neckeropsis undulata and N. disticha were characterized regarding size, number per capsule and viability. Chemical substances were analyzed for P. spiniforme and N. undulata spores. Length of sporophyte seta (spore dispersal ability) was analyzed for P. spiniforme. Four to six colonies per species in each site (lowland and highland areas of an Atlantic Forest; Serra do Mar State Park, Brazil) were visited for the collection of capsules (2008 - 2009). Neckeropsis undulata in the highland area produced the largest spores (ca. 19 µm) with the highest viability. The smallest spores were found in N. disticha in the lowland (ca. 13 µm). Pyrrhobryum spiniforme produced more spores per capsule in the highland (ca. 150,000) than in lowland (ca. 40,000); longer sporophytic setae in the lowland (ca. 64 mm) than in the highland (ca. 43 mm); and similar sized spores in both areas (ca. 16 µm). Spores of N. undulata and P. spiniforme contained lipids and proteins in the cytoplasm, and acid/neutral lipids and pectins in the wall. Lipid bodies were larger in N. undulata than in P. spiniforme. No starch was recorded for spores. Pyrrhobryum spiniforme in the highland area, different from lowland, was characterized by low reproductive effort, but presented many spores per capsule.

Formação das substâncias de reserva durante o desenvolvimento de sementes de urucum (Bixa orellana L. - Bixaceae)

Annatto seeds do not germinate during early stages of their development because of insufficient reserve substances. In situ analysis showed that the principal reserves are proteins and starch, deposited in endosperm cells. During the early stages of development, the starch grains were elliptic, because amylose was the minor component. During development, these grains became more spherical due to an increase in amylose relative to amylopectin. Endosperm cells do not contain protein bodies, but they accumulate proteins dispersed in the cytoplasm. At the final stage of development the proteins became compacted due to the dehydration of the seeds wich is part of the global process of orthodox seeds maturation. Natural fluorescence revealed aromatic amino acids, principally tryptophan and tyrosine in the proteins. The seeds reached their maximum dry weight after moisture contents had declined to around 60%. At this point the seeds presented maximum germination capacity.

Influência da atividade física na qualidade de vida e auto-imagem de mulheres incontinentes

Our aim was to verify the influence of a physical activities proposal in the quality of life and self image of incontinent women. This study was comparative and exploratory and was developed in 16 weeks. Thirty-seven women with and without urinary incontinence (IU) participated in the study. After the study, significant improvement in general health perception (p < 0.001), UI impact (p = 0.035), physical limitations (p = 0.015), personal relations, (p = 0.048), sleep and disposition (p = 0.012) and concerned with the gravity measurements (p = 0.011) was observed. Concerning self image, alterations in appearance were not observed; however, concerning body satisfaction, the women felt less satisfied with their bodies (p = 0.007). There was a reduction in the number of regions where they felt pain (p = 0.0003) and that they did not like (p = 0.0017). In conclusion, the Physical Education professionals using a systematized and integrated physical activities program can lead the women with IU to significant improvement in the perception of their quality of life and health concerning their self image with improvement of the IU symptoms and reduction of frequency and amount of urinary loss.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Neuronal Ceroid-lipofuscinosis with prominent chorea and without visual manifestations: a case report

A case of neuronal ceroid-lipofuscinosis (NCL) is reported in a 11-year-old girl, whose main symptoms were progressive dementia since the age of 4 years and choreic movements since age 10. Seizures, myoclonus and visual deterioration were absent and optic fundi were normal. A cerebral biopsy disclosed two basic types of stored substance in the cytoplasm of neurons: a) severely balloned nerve cells in cortical layers HI and V contained a non-autofluorescent material, which stained with PAS and Sudan Black B in frozen, but not in paraffin sections; ultrastructurally, these neurons showed abundant corpuscles similar to the membranous cytoplasmic bodies of Tay-Sachs disease and, in smaller amounts, also zebra bodies; b) slightly distended or non-distended neurons in all layers contained lipopigment granules, which were autofluorescent, PAS-positive and sudanophil in both frozen and paraffin sections; their ultrastructure was closely comparable to that of lipofuscin. Similar bodies were found in the swollen segments of axons and in a few astrocytes and endothelial cells. The histochemical and ultrastructural demonstration of large amounts of lipopigments allows a presumptive classification of the case as NCL. However, the presence of involuntary movements, the absence of visual disturbances and the unusual ultrastructural features place the patient into a small heterogeneous group within the NCL. A better classification of such unique instances of the disease must await elucidation of the basic enzymatic defects.

Enunciações afetadas : relações possíveis entre homofobia e esporte

Universidade Estadual de Campinas . Faculdade de Educação Física

Formação empirica na educação superior : um estudo de caso na Faculdade de Educação Fisica da Unicamp

Universidade Estadual de Campinas. Faculdade de Educação Física

Analise cinematica da movimentação dos membros superiores e inferiores, tronco e cabeça durante a marcha de hemipareticos

Universidade Estadual de Campinas . Faculdade de Educação Física

Aspectos da educação do corpo no curriculo de pedagogia

Universidade Estadual de Campinas . Faculdade de Educação Física

Proposição e avaliação de um modelo de representação dos membros superiores e escapula durante a marcha humana

Universidade Estadual de Campinas . Faculdade de Educação Física

Metodologia para descrição da orientação do corpo humano

Universidade Estadual de Campinas. Faculdade de Educação Física

A aula de educação fisica como reprodutora de estereotipos de genero a luz da experiencia no Colegio "Inem Santiago Perez" : Santa-Fé de Bogota-Colombia

Universidade Estadual de Campinas . Faculdade de Educação Física

O corpo feminino no encontro com a antiginastica

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeitos da atividade fisica sobre o sistema locomotor e nos habitos de vida

Universidade Estadual de Campinas. Faculdade de Educação Física

A ginastica vivenciada na escola e analisada na perspectiva da criança

Universidade Estadual de Campinas . Faculdade de Educação Física