Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Candidíase sistêmica com localização encefálica: estudo anátomo-clínico de cinco casos

Central nervous system involvement in Candida septicaemia is rare and not more than four cases have been published in Brazil. Five new cases of systemic candidiasis with cerebral lesions are reported. All patients (four adults and a child) had serious underlying diseases and were submitted to heavy long-term antibiotic therapy with multiple drugs. Seizures in one case and neck stiffness in another were the only neurologic signs that could be attributed to candidiasis. In no case were the lesions severe enough to be considered an immediate cause of death. In three patients, no macroscopic changes were evident in the brain, but microabscesses and granulomata were observed on microscopical examination; another patient had two gross areas with necrotic and haemorrhagic appearance in the cerebral hemispheres; the child had only two microscopic granulomata. The aetiological agent was demonstrated by Grocott's methenamine silver technique in all cases. Involvement of organs other than the central nervous system could be demonstrated in three autopsies. Discussion is confined mainly to such aspects as the contributory factors in the pathogenesis of systemic candidiasis as well as the marked rise in the incidence of this condition in the past few decades. It is suggested that the frequence of monilial septicaemia in Brazil may be far more serious than apparent from the scarcity of reported cases.

Brincando no ambiente natural : uma contribuição para o desenvolvimento sensorio-motor da criança portadora de paralisia cerebral

Universidade Estadual de Campinas . Faculdade de Educação Física

Os sentidos da dança : construção de identidades de dança a partir da experiencia com o ?por qua? grupo experimental de dança

Universidade Estadual de Campinas . Faculdade de Educação Física

Homo-motor, ciborgues e... aha! pessoas : da revolução industrial a revolução da informação

Universidade Estadual de Campinas . Faculdade de Educação Física

Educação fisica adaptada : proposta de ação metodologica para formação universitaria

Universidade Estadual de Campinas. Faculdade de Educação Física

Torcidas organizadas e seus jovens torcedores : diversidades e normativas do torcer = Torcidas organizadas and their young supporters : diversities and normatives of supporting

Universidade Estadual de Campinas . Faculdade de Educação Física

Vivencias corporais na escola : uma experiencia com professores de educação infantil e das quatro series iniciais do ensino fundamental

Universidade Estadual de Campinas . Faculdade de Educação Física

Modificações morfo-funcionais do tecido muscular induzidas pela atividade excentrica : um estudo global dos processos adaptativos

Universidade Estadual de Campinas . Faculdade de Educação Física

A pratica do basquetebol feminino no estado de São Paulo : conhecendo e analisando seu contexto

Universidade Estadual de Campinas . Faculdade de Educação Física

Lazer e grupos sociais ; : concepções e metodo

Universidade Estadual de Campinas . Faculdade de Educação Física

Jogos desportivos coletivos e os estimulos das inteligencias multiplas : bases para uma proposta em pedagogia do esporte

Universidade Estadual de Campinas. Faculdade de Educação Física

Evaluation of iris color stability in ocular prosthesis

Accurate iris reproduction in the fabrication of ocular prosthesis in order to match the remaining eye is a key factor to mask the loss and achieve an esthetic outcome for anophthalmic patients. This study evaluated the stability of acrylic paints used for replicating iris color in ocular prostheses by the analysis of two factors: the temperature of the acrylic resin polymerization cycle during prosthesis fabrication and the incidence of sun light, which is the main photodegrading agent undermining the longevity of ocular prostheses. An accelerated aging assay was used for both analyses. Specimens simulating the prosthetic iris in the colors blue, yellow, black, brown and green were fabricated, and were submitted to a colorimetric reading before and after undergoing the thermal conditions of acrylic resin polymerization. Next, the specimens were submitted to an artificial accelerated aging assay with ultraviolet radiation A and weekly colorimetric readings during a 3-week period. The color change (??*) values for the four specimens painted with the same color paint were averaged and the resulting values were considered for statistical analysis. Levine's test and Student's t-test were used to analyze the influence of the temperature of the polymerization cycle during prosthesis fabrication on the color stability of each acrylic resin paint. Friedman's test for three dependent samples was used for analysis of color photodegradation as function of time. Significance level was set at 0.05 for all analyses. It was observed that, after the action of the temperature of the polymerization cycle, alteration above clinically acceptable level of ??*> 3.3 was observed only for the yellow color. After the accelerated aging assay, there were statistically significant differences (p<0.05) as a function of time in the green, brown, black and blue colors. Changes were clinically acceptable for the brown and black colors; slightly above the clinically acceptable limit for the green color; and significantly high and impracticable from a clinical standpoint for the blue color. There was no statistically significant differences (p>0.05) for the yellow color, which presented color change only a little above the clinically acceptable limit. In conclusion: 1. Only the yellow color presented alterations above the clinically acceptable levels after the polymerization cycle; 2. After accelerated aging, there was no changes in the yellow color above the clinically acceptable levels; 3. For the green color, degradation was significant and slightly above the clinically acceptable levels; 4. The black, brown and blue colors presented significant alterations as function of time; the alterations of the brown and black colors were within acceptable clinical levels, while the blue color presented a more accentuated degradation over time.

Distribution of biotypes and leukotoxic activity of Aggregatibacter actinomycetemcomitans isolated from Brazilian patients with chronic periodontitis

Aggregatibacter actinomycetemcomitans is an important etiologic agent of the periodontitis and is associated with extra-oral infections. In this study, the detection of the ltxA gene as well as the ltx promoter region from leukotoxic A. actinomycetemcomitans isolated from 50 Brazilian patients with periodontitis and 50 healthy subjects was performed. The leukotoxic activity on HL-60 cells was also evaluated. Leukotoxic activity was determined using a trypan blue exclusion method. The 530 bp deletion in the promoter region was evaluated by PCR using a PRO primer pair. A. actinomycetemcomitans was detected by culture and directly from crude subgingival biofilm by PCR using specific primers. By culture, A. actinomycetemcomitans was detected in nine (18%) of the periodontal patients and one (2%) healthy subject. However, by PCR, this organism was detected in 44% of the periodontal patients and in 16% of the healthy subjects. It was verified a great discrepancy between PCR detection of the ltx operon promoter directly from crude subgingival biofilm and from bacterial DNA. Only one periodontal sample harbored highly leukotoxic A. actinomycetemcomitans. Moreover, biotype II was the most prevalent and no correlation between biotypes and leukotoxic activity was observed. The diversity of leukotoxin expression by A. actinomycetemcomitans suggests a role of this toxin in the pathogenesis of periodontal disease and other infectious diseases.