970 resultados para Lobomycosis-like disease
Resumo:
Machado-Joseph disease (MJD/SCA3) is the most frequent spinocerebellar ataxia, characterized by brainstem, basal ganglia and cerebellar damage. Few magnetic resonance imaging based studies have investigated damage in the cerebral cortex. The objective was to determine whether patients with MJD/SCA3 have cerebral cortex atrophy, to identify regions more susceptible to damage and to look for the clinical and neuropsychological correlates of such lesions. Forty-nine patients with MJD/SCA3 (mean age 47.7 ± 13.0 years, 27 men) and 49 matched healthy controls were enrolled. All subjects underwent magnetic resonance imaging scans in a 3 T device, and three-dimensional T1 images were used for volumetric analyses. Measurement of cortical thickness and volume was performed using the FreeSurfer software. Groups were compared using ancova with age, gender and estimated intracranial volume as covariates, and a general linear model was used to assess correlations between atrophy and clinical variables. Mean CAG expansion, Scale for Assessment and Rating of Ataxia (SARA) score and age at onset were 72.1 ± 4.2, 14.7 ± 7.3 and 37.5 ± 12.5 years, respectively. The main findings were (i) bilateral paracentral cortex atrophy, as well as the caudal middle frontal gyrus, superior and transverse temporal gyri, and lateral occipital cortex in the left hemisphere and supramarginal gyrus in the right hemisphere; (ii) volumetric reduction of basal ganglia and hippocampi; (iii) a significant correlation between SARA and brainstem and precentral gyrus atrophy. Furthermore, some of the affected cortical regions showed significant correlations with neuropsychological data. Patients with MJD/SCA3 have widespread cortical and subcortical atrophy. These structural findings correlate with clinical manifestations of the disease, which support the concept that cognitive/motor impairment and cerebral damage are related in disease.
Resumo:
Machado-Joseph disease (SCA3) is the most frequent spinocerebellar ataxia worldwide and characterized by remarkable phenotypic heterogeneity. MRI-based studies in SCA3 focused in the cerebellum and connections, but little is known about cord damage in the disease and its clinical relevance. To evaluate the spinal cord damage in SCA3 through quantitative analysis of MRI scans. A group of 48 patients with SCA3 and 48 age and gender-matched healthy controls underwent MRI on a 3T scanner. We used T1-weighted 3D images to estimate the cervical spinal cord area (CA) and eccentricity (CE) at three C2/C3 levels based on a semi-automatic image segmentation protocol. The scale for assessment and rating of ataxia (SARA) was employed to quantify disease severity. The two groups-SCA3 and controls-were significantly different regarding CA (49.5 ± 7.3 vs 67.2 ± 6.3 mm(2), p < 0.001) and CE values (0.79 ± 0.06 vs 0.75 ± 0.05, p = 0.005). In addition, CA presented a significant correlation with SARA scores in the patient group (p = 0.010). CE was not associated with SARA scores (p = 0.857). In the multiple variable regression, we found that disease duration was the only variable associated with CA (coefficient = -0.629, p = 0.025). SCA3 is characterized by cervical cord atrophy and antero-posterior flattening. In addition, the spinal cord areas did correlate with disease severity. This suggests that quantitative analyses of the spinal cord MRI might be a useful biomarker in SCA3.
Resumo:
Dysphagia is relatively common in individuals with neurological disorders. To describe the swallowing management and investigate associated factors with swallowing in a case series of patients with Parkinson's disease. It is a long-term study with 24 patients. The patients were observed in a five-year period (2006-2011). They underwent Fiberoptic Endoscopic Evaluation of Swallowing, Functional Oral Intake Scale and therapeutic intervention every three months. In the therapeutic intervention they received orientation about exercises to improve swallowing. The Chi-square, Kruskal-Wallis and Fisher's tests were used. The period of time for improvement or worsening of swallowing was described by Kaplan-Meier analysis. During the follow-up, ten patients improved, five stayed the same and nine worsened their swallowing functionality. The median time for improvement was ten months. Prior to the worsening there was a median time of 33 months of follow-up. There was no associated factor with improvement or worsening of swallowing. The maneuvers frequently indicated in therapeutic intervention were: chin-tuck, bolus consistency, bolus effect, strengthening-tongue, multiple swallows and vocal exercises. The swallowing management was characterized by swallowing assessment every three months with indication of compensatory and rehabilitation maneuvers, aiming to maintain the oral feeding without risks. There was no associated factor with swallowing functionality in this case series.
Resumo:
Olanzapine, an atypical antipsychotic drug, was administered to a patient with Huntington's disease (HD) with marked choreiform movements. Brain SPECT with 99mTc-HMPAO was performed before and after treatment. Brain SPECT imaging has been performed in patients with HD in order to determine the status of basal ganglia perfusion. The use of brain SPECT with 99mTc-HMPAO before and after treatment in patients with HD has not been yet reported. The marked hypoperfusion of the basal ganglia on brain SPECT performed before therapy with olanzapine improved significantly after treatment.
Resumo:
The clinical and neurological findings of three neonates with the diagnosis of cerebrovascular disease are reported. The neuropsychological evaluation disclosed impairment of fine motor function, coordination, language, perception and behavioral disturbances. Brain SPECT imaging revealed perfusional deficits in the three cases.
Resumo:
Huntington disease (HD) is a progressive neurodegenerative disorder with autosomal dominant inheritance, characterized by choreiform movements and cognitive impairment. Onset of symptoms is around 40 years of age and progression to death occurs in approximately 10 to 15 years from the time of disease onset. HD is associated with an unstable CAG repeat expansion at the 5' and of the IT15 gene. We have genotyped the CAG repeat in the IT15 gene in 44 Brazilian individuals (42 patients and 2 unaffected family members) belonging to 34 unrelated families thought to segregate HD. We found one expanded CAG allele in 32 individuals (76%) belonging to 25 unrelated families. In these HD patients, expanded alleles varied from 43 to 73 CAG units and normal alleles varied from 18 to 26 CAGs. A significant negative correlation between age at onset of symptoms and size of the expanded CAG allele was found (r=0.6; p=0.0001); however, the size of the expanded CAG repeat could explain only about 40% of the variability in age at onset (r2=0.4). In addition, we genotyped 25 unrelated control individuals (total of 50 alleles) and found normal CAG repeats varying from 16 to 33 units. The percentage of heterozigocity of the normal allele in the control population was 88%. In conclusion, our results showed that not all patients with the HD phenotype carried the expansion at the IT15 gene. Furthermore, molecular diagnosis was possible in all individuals, since no alleles of intermediate size were found. Therefore, molecular confirmation of the clinical diagnosis in HD should be sought in all suspected patients, making it possible for adequate genetic counseling.
Resumo:
A missense G209A mutation of the alpha-synuclein gene was recently described in a large Contursi kindred with Parkinson's disease (PD). The objective of this study is to determine if the mutation G209A of the alpha-synuclein gene was present in 10 Brazilian families with PD. PD patients were recruited from movement disorders clinics of Brazil. A family history with two or more affected in relatives was the inclusion criterion for this study. The alpha-synuclein G209A mutation assay was made using polymerase chain reaction and the restriction enzyme Tsp45I. Ten patients from 10 unrelated families were studied. The mean age of PD onset was 42.7 years old. We did not find the G209A mutation in our 10 families with PD. Our results suggest that alpha-synuclein mutation G209A is uncommon in Brazilian PD families.
Resumo:
Machado-Joseph disease (MJD) is the most common autosomal dominant spinocerebellar ataxia and presents great phenotypic variability. MJD presenting with spastic paraparesis was recently described in Japanese patients. We report the case of 41-year-old woman with the phenotype of complicated hereditary spastic paraplegia. Her father died at the age of 56 years due to an undiagnosed progressive neurological disease that presented parkinsonism. She had an expanded allele with 66 CAG repeats and a normal allele with 22 repeats in the gene of MJD. MJD should be considered in the differential diagnosis of autosomal dominant complicated HSP. A patient with the phenotype of complicated HSP and relatives with other clinical features of a neurodegenerative disease should raise the suspicion of MJD.
Resumo:
Whipple's disease (WD) is an uncommon multisystem condition caused by the bacillus Tropheryma whipplei. Central nervous system involvement is a classical feature of the disease observed in 20 to 40% of the patients. We report the case of a 62 yeards old man with WD that developed neurological manifestations during its course, and discuss the most usual signs and symptoms focusing on recent diagnostic criteria and novel treatment regimens.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
Dry eye disease and ocular surface disorders may be caused or worsened by viral agents. There are several known and suspected virus associated to ocular surface diseases. The possible pathogenic mechanisms for virus-related dry eye disease are presented herein. This review serves to reinforce the importance of ophthalmologists as one of the healthcare professional able to diagnose a potentially large number of infected patients with high prevalent viral agents.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Dental caries is a transmissible infectious disease in which mutans streptococci are generally considered to be the main etiological agents. Although the transmissibility of dental caries is relatively well established in the literature, little is known whether information regarding this issue is correctly provided to the population. The present study aimed at evaluating, by means of a questionnaire, the knowledge and usual attitude of 640 parents and caretakers regarding the transmissibility of caries disease. Most interviewed adults did not know the concept of dental caries being an infectious and transmissible disease, and reported the habit of blowing and tasting food, sharing utensils and kissing the children on their mouth. 372 (58.1%) adults reported that their children had already been seen by a dentist, 264 (41.3%) answered that their children had never gone to a dentist, and 4 (0.6%) did not know. When the adults were asked whether their children had already had dental caries, 107 (16.7%) answered yes, 489 (76.4%) answered no, and 44 (6.9%) did not know. Taken together, these data reinforce the need to provide the population with some important information regarding the transmission of dental caries in order to facilitate a more comprehensive approach towards the prevention of the disease.
Resumo:
This in vitro study evaluated the cytotoxicity of an experimental restorative composite resin subjected to different light-curing regimens. METHODS: Forty round-shaped specimens were prepared and randomly assigned to four experimental groups (n=10), as follows: in Group 1, no light-curing; in Groups 2, 3 and 4, the composite resin specimens were light-cured for 20, 40 or 60 s, respectively. In Group 5, filter paper discs soaked in 5 µL PBS were used as negative controls. The resin specimens and paper discs were placed in wells of 24-well plates in which the odontoblast-like cells MDPC-23 (30,000 cells/cm²) were plated and incubated in a humidified incubator with 5% CO2 and 95% air at 37ºC for 72 h. The cytotoxicity was evaluated by the cell metabolism (MTT assay) and cell morphology (SEM). The data were analyzed statistically by Kruskal-Wallis and Mann-Whitney tests (p<0.05). RESULTS: In G1, cell metabolism decreased by 86.2%, indicating a severe cytotoxicity of the non-light-cured composite resin. On the other hand, cell metabolism decreased by only 13.3% and 13.5% in G2 and G3, respectively. No cytotoxic effects were observed in G4 and G5. In G1, only a few round-shaped cells with short processes on their cytoplasmic membrane were observed. In the other experimental groups as well as in control group, a number of spindle-shaped cells with long cytoplasmic processes were found. CONCLUSION: Regardless of the photoactivation time used in the present investigation, the experimental composite resin presented mild to no toxic effects to the odontoblast-like MDPC-23 cells. However, intense cytotoxic effects occurred when no light-curing was performed.