Relationship Between Aerobic And Anaerobic Parameters From 3-minute All-out Tethered Swimming And 400-m Maximal Front Crawl Effort.

The main aim of this investigation was to verify the relationship of the variables measured during a 3-minute all-out test with aerobic (i.e., peak oxygen uptake [(Equation is included in full-text article.)] and intensity corresponding to the lactate minimum [LMI]) and anaerobic parameters (i.e., anaerobic work) measured during a 400-m maximal performance. To measure force continually and to avoid the possible influences caused by turns, the 3-minute all-out effort was performed in tethered swimming. Thirty swimmers performed the following tests: (a) a 3-minute all-out tethered swimming test to determine the final force (equivalent to critical force: CF3-MIN) and the work performed above CF3-MIN (W'3-MIN), (b) a LMI protocol to determine the LMI during front crawl swimming, and (c) a 400-m maximal test to determine the (Equation is included in full-text article.)and total anaerobic contribution (WANA). Correlations between the variables were tested using the Pearson's correlation test (p ≤ 0.05). CF3-MIN (73.9 ± 13.2 N) presented a high correlation with the LMI (1.33 ± 0.08 m·s; p = 0.01) and (Equation is included in full-text article.)(4.5 ± 1.2 L·min; p = 0.01). However, the W'3-MIN (1,943.2 ± 719.2 N·s) was only moderately correlated with LMI (p = 0.02) and (Equation is included in full-text article.)(p = 0.01). In summary, CF3-MIN determined during the 3-minute all-out effort is associated with oxidative metabolism and can be used to estimate the aerobic capacity of swimmers. In contrast, the anaerobic component of this model (W'3-MIN) is not correlated with WANA.

Chromobacterium Amazonense Sp. Nov. Isolated From Water Samples From The Rio Negro, Amazon, Brazil.

The taxonomic position of a bacterium isolated from water samples from the Rio Negro, in Amazon, Brazil, was determined by using a polyphasic approach. The organism formed a distinct phyletic line in the Chromobacterium 16S rRNA gene tree and had chemotaxonomic and morphological properties consistent with its classification in this genus. It was found to be closely related to Chromobacterium vaccinii DSM 25150(T) (98.6 % 16S rRNA gene similarity) and shared 98.5 % 16S rRNA gene similarity with Chromobacterium piscinae LGM 3947(T). DNA-DNA relatedness studies showed that isolate CBMAI 310(T) belongs to distinct genomic species. The isolate was readily distinguished from the type strain of these species using a combination of phenotypic and chemotaxonomic properties. Thus, based on genotypic and phenotypic data, it is proposed that isolate CBMAI 310(T) (=DSM 26508(T)) be classified in the genus Chromobacterium as the type strain of a novel species, namely, Chromobacterium amazonense sp. nov.

Gluttonous predators: how to estimate prey size when there are too many prey

Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.

Behaviour of albino and melanic variants of Biomphalaria glabrata Say, 1818 (Mollusca: Planorbidae) following infection by Schistosoma mansoni Sambon, 1907

The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.

Evaluation of the cytotoxic and genotoxic potential of water from the River Paraíba do Sul, in Brazil, with the Allium cepa L. test

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) food habits in a mosaic of Atlantic Rainforest and eucalypt plantations of southeastern Brazil

Food habits of jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) were studied between November 2000 and November 2001, in a 24.9 km² area of secondary Atlantic Rainforest and eucalypt plantation, in the Serra de Paranapiacaba, São Paulo State, Brazil. Analyses of 26 fecal and regurgitate samples, obtained over a stretch of 570.1 km, showed the consumption of 19 prey items and 74 prey occurrences. Small mammals were the most frequent food item (42.5%), followed by birds (21%), reptiles (14%) and medium-sized mammals (3%). The percent occurrence (PO) suggests that the diet consisted mainly of small rodents (30%) and birds (21%). We recorded for the first time the predation of Viperidae snakes by P. yagouaroundi. Although having a large list of items and range of dietary niche breadths (Bsta = 0.76), our data show that jaguarundi prey mainly on small vertebrates (mammals, birds or reptiles), and even in tall tropical forests or eucalypt plantations, it preys mostly on animals that come to, or live on, the ground.

Apedunculata discoidea gen. n., sp. n. (Monogenea: Dactylogyridae) parasitic on Prochilodus lineatus (Valenciennes, 1837) (Characiformes: Prochilodontidae) from southeastern Brazil

A new species of dactylogyrid monogenean, Apedunculata discoidea gen. n., sp. n. is described and illustrated from the gills of the freshwater fish Prochilodus lineatus (Valenciennes, 1837) in pisciculture ponds from Pirassununga, São Paulo, Brazil. Diagnostic characters of the new genus and species are: 1) vagina dextrolateral slightly sclerotised, opening anteriorly at level of copulatory complex; 2) copulatory organ coiled with two counterclockwise rings; 3) Accessory piece distal and not articulated; 4) body disk-shaped, lacking a peduncle.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Isolation and characterization of Flavobacterium columnare (Bernardet et al. 2002) from four tropical fish species in Brazil

Flavobacterium columnare is the causative agent of columnaris disease in freshwater fish, implicated in skin and gill disease, often causing high mortality. The aim of this study was the isolation and characterization of Flavobacterium columnare in tropical fish in Brazil. Piracanjuba (Brycon orbignyanus), pacu (Piaractus mesopotamicus), tambaqui (Colossoma macropomum) and cascudo (Hypostomus plecostomus) were examined for external lesions showing signs of colunmaris disease such as greyish white spots, especially on the head, dorsal part and caudal fin of the fish. The sampling comprised 50 samples representing four different fish species selected for study. Samples for culture were obtained by skin and kidney scrapes with a sterile cotton swabs of columnaris disease fish and streaked onto Carlson and Pacha (1968) artificial culture medium (broth and solid) which were used for isolation. The strains in the liquid medium were Gram negative, long, filamentous, exhibited flexing movements (gliding motility), contained a large number of long slender bacteria and gathered into ‘columns'. Strains on the agar produced yellow-pale colonies, rather small, flat that had rhizoid edges. A total of four Flavobacterium columnare were isolated: 01 Brycon orbignyanus strain, 01 Piaractus mesopotamicus strain, 01 Colossoma macropomum strain, and 01 Hypostomus plecostomus strain. Biochemical characterization, with its absorption of Congo red dye, production of flexirubin-type pigments, H2S production and reduction of nitrates proved that the isolate could be classified as Flavobacterium columnare.

Age polyethism in Plebeia emerina (Friese) (Hymenoptera: Apidae) colonies related to propolis handling

Stingless bees collect plant resins and make it into propolis, although they have a wider range of use for this material than do honey bees (Apis spp.). Plebeia spp. workers employ propolis mixed with wax (cerumen) for constructing and sealing nest structures, while they use viscous (sticky) propolis for defense by applying it onto their enemies. Isolated viscous propolis deposits are permanently maintained at the interior of their colonies, as also seen in other Meliponini species. Newly-emerged Plebeia emerina (Friese) workers were observed stuck to and unable to escape these viscous propolis stores. We examined the division of labor involved in propolis manipulation, by observing marked bees of known age in four colonies of P. emerina from southern Brazil. Activities on brood combs, the nest involucrum and food pots were observed from the first day of life of the marked bees. However, work on viscous propolis deposits did not begin until the 13th day of age and continued until the 56th day (maximum lifespan in our sample). Although worker bees begin to manipulate cerumen early, they seem to be unable to handle viscous propolis till they become older.

Seasonal variation of soluble carbohydrates and starch in Echinolaena inflexa, a native grass species from the Brazilian savanna, and in the invasive grass Melinis minutiflora

Echinolaena inflexa (Poir.) Chase is an abundant C3 grass species with high biomass production in the Brazilian savanna (cerrado); Melinis minutiflora Beauv. is an African C4 forage grass widespread in cerrado and probably displacing some native herbaceous species. In the present work, we analysed seasonally the content and composition of soluble carbohydrates, the starch amounts and the above-ground biomass (phytomass) of E. inflexa and M. minutiflora plants harvested in two transects at 5 and 130 m from the border in a restrict area of cerrado at the Biological Reserve and Experimental Station of Mogi-Guaçu (SP, Brazil). Results showed that water soluble carbohydrates and starch amounts from the shoots of both species varied according to the time of the year, whilst in the underground organs, variations were observed mainly in relation to the transects. Marked differences in the pattern of the above-ground biomass production between these two grasses relative to their location in the Reserve were also observed, with two peaks of the invasive species (July and January) at the Reserve border. The differences in carbohydrate accumulation, partitioning and composition of individual sugars concerning time of the year and location in the Reserve were more related to the annual growth cycle of both grasses and possibly to specific physiological responses of M. minutiflora to disturbed environments in the Reserve border.

Population dynamics: seasonal variation of phytoplankton functional groups in brazilian reservoirs (Billings and Guarapiranga, São Paulo)

Phytoplankton may function as a "sensor" of changes in aquatic environment and responds rapidly to such changes. In freshwaters, coexistence of species that have similar ecological requirements and show the same environmental requirements frequently occurs; such species groups are named functional groups. The use of phytoplankton functional groups to evaluate these changes has proven to be very useful and effective. Thus, the aim of this study was to evaluate the occurrence of functional groups of phytoplankton in two reservoirs (Billings and Guarapiranga) that supply water to millions of people in São Paulo city Metropolitan Area, southeastern Brazil. Surface water samples were collected monthly and physical, chemical and biological (quantitative and qualitative analyses of the phytoplankton) were performed. The highest biovolume (mm³.L-1) of the descriptor species and functional groups were represented respectively by Anabaena circinalis Rabenh. (H1), Microcystis aeruginosa (Kützing) Kützing (L M/M) and Mougeotia sp. (T) in the Guarapiranga reservoir and Cylindrospermopsis raciborskii (Wolosz.) Seen. and Subba Raju (S N), Microcystis aeruginosa and M. panniformis Komárek et al. (L M/M), Planktothrix agardhii (Gom.) Anagn. and Komárek and P. cf. clathrata (Skuja) Anagn. and Komárek (S1) in the Billings reservoir. The environmental factors that most influenced the phytoplankton dynamics were water temperature, euphotic zone, turbidity, conductivity, pH, dissolved oxygen, nitrate and total phosphorous.

Effects of human trampling on a rocky shore fauna on the Sao Paulo coast, southeastern Brazil

Increased tourist activity in coastal regions demands management strategies to reduce impacts on rocky shores. The highly populated coastal areas in southeastern Brazil are an example of degradation caused by development of industry and tourism. Among different shore impacts, trampling has been intensively studied, and may represent a significant source of stress for intertidal fauna. A randomised blocks design was applied to experimentally study the effects of two different trampling intensities on richness, diversity, density and biomass of the rocky shore fauna of Obuseiro beach, Guarujá, southeastern Brazil. Blocks were distributed in two portions of the intertidal zone, dominated respectively by Chthamalus bisinuatus (Cirripedia) and Isognomon bicolor (Bivalvia). Blocks were trampled over three months, simulating the vacation period in Brazil and were monitored for the following nine months. Results indicate that Chthamalus bisinuatus is vulnerable to trampling impacts. Richness, diversity and turn-over index tended to be higher in trampled plots four months after trampling ceased. In general, results agree with previous trampling studies, suggesting that even low intensities of trampling may cause some impact on intertidal communities. Management strategies should include isolation of sensitive areas, construction of boardwalks, visitor education and monitoring programmes. In Brazil, additional data obtained from experimental studies are necessary in order to achieve a better understanding of trampling impacts on rocky shore communities.

Frugivory and seed dispersal of golden lion tamarin (Leontopithecus rosalia (Linnaeus, 1766)) in a forest fragment in the Atlantic Forest, Brazil

The influence of the golden lion tamarin (Leontopithecus rosalia) as a seed disperser was studied by monitoring two groups of tamarins from December 1998 to December 2000 (871.9 hours of observations) in a forest fragment in south-east Brazil. The tamarins consumed fruits of 57 species from at least 17 families. They ingested the seeds of 39 species, and 23 of these were put to germinate in the laboratory and/or in the field. L. rosalia is a legitimate seed disperser because the seeds of all species tested germinated after ingestion, albeit some in low percentages. These primates do not show a consistent effect in final seed germination, because they benefit some species while damaging others. Feces were examined for seeds that had been preyed upon or digested.

A comparison of the leaf-litter ant fauna in a secondary atlantic forest with an adjacent pine plantation in southeastern Brazil

We investigated the influence of Pinus afforestation on the structure of leaf-litter ant communities in the southeastern Brazilian Atlantic Forest, studying an old secondary forest and a nearly 30 year-old never managed Pinus elliottii reforested area. A total of 12,826 individual ants distributed among 95 species and 32 genera were obtained from 50 1 m² samples/ habitat. Of these, 60 species were recorded in the pine plantation and 82 in the area of Atlantic forest; almost 50% of the species found in the secondary forest area were also present in the pine plantation. The number of species per sample was significantly higher in the secondary forest than in the pine plantation. Forest-adapted taxa are the most responsible for ant species richness differences between areas, and the pine plantation is richer in species classified as soil or litter omnivorous-dominants. The specialized ant predators registered in the pine plantation, as seven Dacetini, two Basiceros, two Attini and two Discothyrea, belong to widely distributed species. The NMDS (non-metric multidimensional scaling) ordination also suggested strong differences in similarity among samples of the two areas. Furthermore, this analysis indicated higher sample heterogeneity in the secondary forest, with two clusters of species, while in the pine plantation the species belong to a single cluster. We applied the ant mosaic hypothesis to explain the distribution of the leaf-litter fauna and spatial autocorrelation tests among samples. We argue that the results are likely related to differences in quality and distribution of the leaf-litter between the pine plantation and the secondary area.