970 resultados para Variability intra-specific
Resumo:
American tegumentary leishmaniasis (ATL) is a disease transmitted to humans by the female sandflies of the genus Lutzomyia. Several factors are involved in the disease transmission cycle. In this work only rainfall and deforestation were considered to assess the variability in the incidence of ATL. In order to reach this goal, monthly recorded data of the incidence of ATL in Orán, Salta, Argentina, were used, in the period 1985-2007. The square root of the relative incidence of ATL and the corresponding variance were formulated as time series, and these data were smoothed by moving averages of 12 and 24 months, respectively. The same procedure was applied to the rainfall data. Typical months, which are April, August, and December, were found and allowed us to describe the dynamical behavior of ATL outbreaks. These results were tested at 95% confidence level. We concluded that the variability of rainfall would not be enough to justify the epidemic outbreaks of ATL in the period 1997-2000, but it consistently explains the situation observed in the years 2002 and 2004. Deforestation activities occurred in this region could explain epidemic peaks observed in both years and also during the entire time of observation except in 2005-2007.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
X-linked adrenoleukodystrophy (X-ALD) is an inherited disease with clinical heterogeneity varying from presymptomatic individuals to rapidly progressive cerebral ALD forms. This disease is characterized by increased concentration of very long chain fatty acids (VLCFAs) in plasma and in adrenal, testicular and nervous tissues. Affected individuals can be classified in different clinical settings, according to phenotypic expression and age at onset of initial symptoms. Molecular defects in X-ALD individuals usually result from ABCD1 gene mutations. In the present report we describe clinical data and the ABCD1 gene study in two boys affected with the childhood cerebral form that presented with different symptomatic manifestations at diagnosis. In addition, their maternal grandfather had been diagnosed with Addison's disease indicating phenotypic variation for X-ALD within this family. The mutation p.Trp132Ter was identified in both male patients; additionally, three females, out of eleven family members, were found to be heterozygous after screening for this mutation. In the present report, the molecular analysis was especially important since one of the heterozygous females was in first stages of pregnancy. Therefore, depending on the fetus outcome, if male and p.Trp132Ter carrier, storage of the umbilical cord blood should be recommended as hematopoietic stem cell transplantation could be considered as an option for treatment in the future.
Resumo:
PURPOSE: To evaluate changes in retinal nerve fiber layer thickness as measured by scanning laser polarimetry (SLP) after the use of medication to reduce intraocular pressure (IOP) in glaucomatous or ocular hypertensive patients. METHODS: The authors prospectively enrolled 37 eyes of 37 patients in whom IOP was reduced by more than 25% after the use of medication. The images were obtained before and 15 to 30 days after the introduction of medication. The SLP parameters measured before and after the use of medication were compared using paired Student's t Test. RESULTS: The mean IOP was significantly reduced from 26.57±4.23 mmHg to 16.54 ±2.92 mmHg after the use of medication (p<0.05). None of the 10 SLP analyzed parameters was significantly affected by the reduction of IOP with medication (p>0.05). CONCLUSION: The retinal nerve fiber layer thickness, as measured by SLP, is not affected by the reduction of IOP with medication in patients with glaucoma or ocular hypertension.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Bonded maxillary expansion appliances have been suggested to control increases in the vertical dimension of the face after rapid maxillary expansion (RME). However, there is still no consensus in the literature about its real skeletal effects. The purpose of this prospective study was to evaluate, longitudinally, the vertical and sagittal cephalometric alterations after RME performed with bonded maxillary expansion appliance. The sample consisted of 26 children, with a mean age of 8.7 years (range: 6.9-10.9 years), with posterior skeletal crossbite and indication for RME. After maxillary expansion, the bonded appliance was used as a fixed retention for 3.4 months, being replaced by a removable retention subsequently. The cephalometric study was performed onto lateral radiographs, taken before treatment was started, and again 6.3 months after removing the bonded appliance. Intra-group comparison was made using paired t test. The results showed that there were no significant sagittal skeletal changes at the end of treatment. There was a small vertical skeletal increase in five of the eleven evaluated cephalometric measures. The maxilla displaced downward, but it did not modify the facial growth patterns or the direction of the mandible growth. Under the specific conditions of this research, it may be concluded that RME with acrylic bonded maxillary expansion appliance did promote signifciant vertical or sagittal cephalometric alterations. The vertical changes found with the use of the bonded appliance were small and probably transitory, similar to those occurred with the use of banded expansion appliances.
Resumo:
Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.