986 resultados para SOUTH AMERICAN CLIMATE


Relevância:

90.00% 90.00%

Publicador:

Resumo:

Numerous studies use major element concentrations measured on continental margin sediments to reconstruct terrestrial climate variations. The choice and interpretation of climate proxies however differ from site to site. Here we map the concentrations of major elements (Ca, Fe, Al, Si, Ti, K) in Atlantic surface sediments (36°N-49°S) to assess the factors influencing the geochemistry of Atlantic hemipelagic sediments and the potential of elemental ratios to reconstruct different terrestrial climate regimes. High concentrations of terrigenous elements and low Ca concentrations along the African and South American margins reflect the dominance of terrigenous input in these regions. Single element concentrations and elemental ratios including Ca (e.g., Fe/Ca) are too sensitive to dilution effects (enhanced biological productivity, carbonate dissolution) to allow reliable reconstructions of terrestrial climate. Other elemental ratios reflect the composition of terrigenous material and mirror the climatic conditions within the continental catchment areas. The Atlantic distribution of Ti/Al supports its use as a proxy for eolian versus fluvial input in regions of dust deposition that are not affected by the input of mafic rock material. The spatial distributions of Al/Si and Fe/K reflect the relative input of intensively weathered material from humid regions versus slightly weathered particles from drier areas. High biogenic opal input however influences the Al/Si ratio. Fe/K is sensitive to the input of mafic material and the topography of Andean river drainage basins. Both ratios are suitable to reconstruct African and South American climatic zones characterized by different intensities of chemical weathering in well-understood environmental settings.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Abundant hydroclimatic evidence from western Amazonia and the adjacent Andes documents wet conditions during Heinrich Stadial 1 (HS1, 18-15 ka), a cold period in the high latitudes of the North Atlantic. This precipitation anomaly was attributed to a strengthening of the South American summer monsoon due to a change in the Atlantic interhemispheric sea surface temperature (SST) gradient. However, the physical viability of this mechanism has never been rigorously tested. We address this issue by combining a thorough compilation of tropical South American paleorecords and a set of atmosphere model sensitivity experiments. Our results show that the Atlantic SST variations alone, although leading to dry conditions in northern South America and wet conditions in northeastern Brazil, cannot produce increased precipitation over western Amazonia and the adjacent Andes during HS1. Instead, an eastern equatorial Pacific SST increase (i.e., 0.5-1.5 °C), in response to the slowdown of the Atlantic Meridional Overturning Circulation during HS1, is crucial to generate the wet conditions in these regions. The mechanism works via anomalous low sea level pressure over the eastern equatorial Pacific, which promotes a regional easterly low-level wind anomaly and moisture recycling from central Amazonia towards the Andes.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Hevea brasiliensis is a native species of the Amazon Basin of South America and the primary source of natural rubber worldwide. Due to the occurrence of South American Leaf Blight disease in this area, rubber plantations have been extended to suboptimal regions. Rubber tree breeding is time-consuming and expensive, but molecular markers can serve as a tool for early evaluation, thus reducing time and costs. In this work, we constructed six different cDNA libraries with the aim of developing gene-targeted molecular markers for the rubber tree. A total of 8,263 reads were assembled, generating 5,025 unigenes that were analyzed; 912 expressed sequence tags (ESTs) represented new transcripts, and two sequences were highly up-regulated by cold stress. These unigenes were scanned for microsatellite (SSR) regions and single nucleotide polymorphisms (SNPs). In total, 169 novel EST-SSR markers were developed; 138 loci were polymorphic in the rubber tree, and 98 % presented transferability to six other Hevea species. Locus duplication was observed in H. brasiliensis and other species. Additionally, 43 SNP markers in 13 sequences that showed similarity to proteins involved in stress response, latex biosynthesis and developmental processes were characterized. cDNA libraries are a rich source of SSR and SNP markers and enable the identification of new transcripts. The new markers developed here will be a valuable resource for linkage mapping, QTL identification and other studies in the rubber tree and can also be used to evaluate the genetic variability of other Hevea species, which are valuable assets in rubber tree breeding.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Crotamine is one of the main constituents of the venom of the South American rattlesnake Crotalus durissus terrificus. Here we sought to investigate the inflammatory and toxicological effects induced by the intrahippocampal administration of crotamine isolated from Crotalus whole venom. Adult rats received an intrahippocampal infusion of crotamine or vehicle and were euthanized 24 h or 21 days after infusion. Plasma and brain tissue were collected for biochemical analysis. Complete blood count, creatinine, urea, glutamic oxaloacetic transaminase (GOT), glutamic pyruvic transaminase (GPT), creatine-kinase (CK), creatine kinase-muscle B (CK-MB) and oxidative parameters (assessed by DNA damage and micronucleus frequency in leukocytes, lipid peroxidation and protein carbonyls in plasma and brain) were quantified. Unpaired and paired t-tests were used for comparisons between saline and crotamine groups, and within groups (24 h vs. 21 days), respectively. After 24 h crotamine infusion promoted an increase of urea, GOT, GPT, CK, and platelets values (p ≤ 0.01), while red blood cells, hematocrit and leukocytes values decreased (p ≤ 0.01). Additionally, 21 days after infusion crotamine group showed increased creatinine, leukocytes, TBARS (plasma and brain), carbonyl (plasma and brain) and micronucleus compared to the saline-group (p ≤ 0.01). Our findings show that crotamine infusion alter hematological parameters and cardiac markers, as well as oxidative parameters, not only in the brain, but also in the blood, indicating a systemic pro-inflammatory and toxicological activity. A further scientific attempt in terms of preserving the beneficial activity over toxicity is required.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

In Myrocarpus, an exclusively South American genus, five species are recognised: Myrocarpus frondosus Allemão, M. leprosus Pickel, M. venezuelensis Rudd, M. fastigiatus Allemãoand M. emarginatus A.L.B. Sartori & A.M.G. Azevedo. Morphologic data, habitat information and geographic distribution of each taxon are discussed. Petal morphology and ornamentation of seed chamber are an important character for species identification, though not shown previously. Key to the species, descriptions, illustrations, distribution, and new registers are presented.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Neste trabalho estudou-se a influência dos padrões de onda extratropicais, que favorecem o desenvolvimento de eventos extremos frios no sudeste Sul-Americano, e em particular na região conhecida como Pampa Úmida. O aquecimento anômalo observado na região do oceano Pacífico tropical ocidental a nordeste da Austrália, durante os invernos de máxima freqüência de ocorrência de Geadas Generalizadas (GG) no centro-leste da Argentina, (região conhecida como Pampa Úmida - PU), atua como disparador de ondas de Rossby, as quais se propagam até o continente, favorecendo assim a ocorrência daqueles eventos. O padrão de propagação obtido nas simulações numéricas com um modelo baroclínico global, mostra o predomínio de um número de onda 3. Adicionalmente, foram analisadas as correlações do vento meridional em altos e baixos níveis observados para os eventos de GG, selecionados dentro dos invernos de máxima freqüência de ocorrência desses eventos. O vento meridional global em 250hPa apresenta regiões com correlação estatisticamente significativa com o vento meridional médio na PU. A configuração obtida no caso do vento meridional global em 250hPa, correlacionado com o vento meridional na PU, pode estar associada ao padrão de propagação das ondas simuladas numericamente a partir da forçante tropical. Igualmente importantes e significativos são os valores de correlação do vento sul nos baixos níveis, em particular para toda região da PU. O padrão de ondas simulado está bem representado pelas significativas correlações entre o vento meridional hemisférico em altos níveis e a temperatura no dia de evento de GG.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Os Cerrados sul-americanos abrigam alta diversidade de répteis, incluindo elevado número de endemismos. No entanto, o conhecimento desta diversidade é ainda incompleto frente à acelerada transformação das paisagens naturais no Brasil central. Constituem, portanto, uma das regiões prioritárias para estudo e conservação da biodiversidade mundial. Estudos intensivos sobre a fauna de répteis do Cerrado são necessários e urgentes para melhor compreensão dos processos que levaram à sua origem e distribuição e para subsidiar ações de conservação. Por meio de métodos padronizados, amostramos duas regiões ainda inexploradas da Estação Ecológica Serra Geral do Tocantins, situada na região do Jalapão. Registramos 45 espécies de répteis para a EESGT e entorno, o que representa uma riqueza alta e comparável à de outras regiões bem amostradas do Cerrado. Curvas de acumulação e estimadores indicam que a riqueza local de lagartos e anfisbenídeos aproxima-se da riqueza real enquanto a de serpentes é subestimada. A distribuição não-aleatória das espécies na paisagem concorda com evidências anteriores sugerindo utilização diferencial dos hábitats pelos répteis. Reunindo os resultados do presente estudo com os de levantamentos prévios realizados na região, registramos 88 espécies de répteis para o Jalapão sendo oito registros novos que incluem Bachia oxyrhina uma espécie recém descrita da região. As espécies da área apresentam três padrões gerais de distribuição: (1) espécies endêmicas do Cerrado, (2) espécies compartilhadas com domínios da diagonal de formações abertas sul-americanas, e (3) espécies de ampla ocorrência, compartilhadas também com ecossistemas florestais. Prevalecem espécies de ampla distribuição, porém é grande o número de espécies típicas do Cerrado, incluindo cinco possivelmente endêmicas do Jalapão, e há contribuição importante da fauna da Caatinga. A distribuição dos répteis em escala local e regional demonstra a necessidade de considerar a heterogeneidade paisagística para o planejamento de diretrizes visando à conservação em regiões do Cerrado. Por sua grande extensão, posição biogeográfica e complexidade de relevo e tipos de hábitat, a EESGT tem papel fundamental para a preservação e conhecimento da diversidade de répteis do Cerrado.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Stevia rebaudiana, a South American plant normally used as a natural herbal sweetener, has been suggested as exerting beneficial effects on human health, including as an antihypertensive and antihyperglycemic. The present experiment was undertaken to evaluate the renal excretion of steviol, the aglycone of several natural products extracted from the leaves of S. rebaudiana, and to clarify the actual participation of this compound on the renal excretion of glucose in rats, which has been previously suggested as the preferential action of steviol on the Na+-glucose renal tubular transport system. Steviol was obtained by enzymatic hydrolysis of stevioside with pectinase. Thirty normal male Wistar rats weighing 345 g were used. After a control period, steviol was infused iv at three doses (0.5, 1.0 and 3.0 mg.kg-1/h), according to classical clearance techniques. During all the experiments no significant changes in inulin clearance (Cin) and p-aminohipuric acid clearance (C PAH) were observed. Administration of steviol resulted in a statistically significant increase in the fractional sodium excretion (FeNa+), fractional potassium excretion (FeK+), urinary flow as percent of glomerular filtration rate (V/GFR) and glucose clearance (C G) when compared to controls, but these effects were absent with the dose of 0.5 mg.kg-1/h. The steviol clearance (C S) was higher than the Cin and lower than the C PAH at all the doses employed in this study. The data suggest that steviol is secreted by renal tubular epithelium, causing diuresis, natriuresis, kaliuresis and a fall in renal tubular reabsorption of glucose.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Navicordulia aemulatrix sp. nov. (holotype male deposited in MZSP: Brazil, Santa Catarina State, [São Bento do Sul municipality, 26°14'58"S, 49°22'59"W], [railroad station] Rio Vermelho, II.1952) is described and illustrated based on three males. The long cercus (2.9-3.2 mm) places this species in the longistyla-group together with N. kiautai, N. longistyla and N. nitens but it differs from them mainly by the shape of cercus, with carinated part occupying 0.33 of cercus total length, and also by dorsal, ventro-medial and ventro-lateral tubercles developed. An unusual process on tergal portion of prothorax is reported for the first time in Navicordulia. The rate of description of new species of South American 'Corduliidae' is discussed. A map with records of Atlantic Forest Navicordulia species and a list of Brazilian corduliids by state are also presented.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

O texto apresenta breve introdução à vida e à obra de Giovanni Angelo Brunelli (1722-1804), astrônomo bolonhês que participou da primeira Comissão Demarcadora de Limites entre as possessões de Portugal e Espanha na América do Sul, de 1753 a 1761, a serviço da Coroa lusitana. Em seguida, são publicados os três trabalhos de Brunelli sobre a Amazônia brasileira, tendo como temas a pororoca (1767), a mandioca (1767) e o rio Amazonas (1791); e dois outros documentos relacionadas à comissão, um ofício no qual Brunelli reclama a coordenação dos trabalhos de cartografia (1752) e um rascunho do diário de viagem do astrônomo até o rio Negro (1754). Todos esses documentos foram traduzidos ao português, pela primeira vez, do latim e do italiano.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Caracterizar o estado nutricional de 3.254 Kaingáng de escolas indígenas de 12 terras indígenas do Rio Grande do Sul, Brasil. Transversal de base escolar. Obtidas medidas de peso (P), estatura (E) e circunferência da cintura (CC) conforme Organização Mundial da Saúde - OMS (1995). Classificação do estado nutricional: crianças: índices E/I, P/I e P/E, de acordo com o National Center for Health Statistics (WHO, 1995) e E/I, P/I e índice de massa corporal/idade (IMC/I) de acordo com OMS (2006); adolescentes: IMC/I (OMS, 1995 e 2006) e E/I (OMS, 2006); adultos: IMC (OMS, 1995) e CC (OMS, 2003). Adolescentes representaram 56% dos avaliados, crianças 42,5%, adultos 1,4% e idosos 0,1%. Deficit estatural de 15,1% (OMS, 1995) e 15,5% (OMS, 2006) entre as crianças e de 19,9% entre adolescentes. Freqüências de excesso de peso foram: crianças: 11% (OMS, 1995) e 5,7% (OMS, 2006); adolescentes: 6,7%; adultos: 79,2%. Entre adultos, 45,3% estavam em risco aumentado para doenças metabólicas. Observada a transição nutricional no segmento, caracterizada por prevalências importantes de baixa estatura na infância e adolescência e sobrepeso proeminente em todas as faixas etárias.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

O objetivo do estudo foi realizar uma análise embriológica dos roedores histricomorfos (paca, cutia, preá e capivara), a fim de comparar com a de outros roedores e com a morfogênese humana um padrão embriológico. Utilizaram-se 8 espécimes de roedores sendo, 2 embriões para cada espécie coletada, ambas em inicio de gestação. Estes foram retirados dos úteros gestantes através de ovariosalpingohisterectomia parcial, seguido de fixação em solução de paraformaldeído 4%. Para as mensurações de Crow-Rump, adotou-se como referência a crista nucal numa extremidade e da última vértebra sacral na extremidade oposta. De forma geral, os embriões analisados mostraram as seguintes características morfológicas: divisão dos arcos branquiais, o não fechamento do neuróporo cranial em alguns embriões estudados, a curvatura cranial acentuada e os somitos delimitados e individualizados. O broto dos membros apresentava-se em desenvolvimento em formato de remo, além da impressão cardíaca e fígado. Na região caudal, visualizou-se a curvatura crânio-caudal, a vesícula óptica com e sem pigmentação da retina, a abertura do tubo neural na região do quarto ventrículo encefálico, a fosseta nasal e a formação das vesículas encefálicas. Concluímos que desenvolvimento embriológico dos roedores histricomorfos pode ser comparado à morfogênese de ratos, cobaios, coelhos e humanos nos diferentes estágios de desenvolvimento, tomando apenas o cuidado com as particularidades de cada espécie, além da implementação de tecnologias reprodutivas, especialmente a de embriões, a qual requer o conhecimento do desenvolvimento pré-implantação referente às fases de desenvolvimento.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The bacterium Rickettsia rickettsii is the etiological agent of an acute, severe disease called Rocky Mountain spotted fever in the United States or Brazilian spotted fever (BSF) in Brazil. In addition to these two countries, the disease has also been reported to affect humans in Mexico, Costa Rica, Panama, Colombia and Argentina. Like humans, dogs are also susceptible to R. rickettsii infection. However, despite the wide distribution of R. rickettsii in the Western Hemisphere, reports of R. rickettsii-induced illness in dogs has been restricted to the United States. The present study evaluated the pathogenicity for dogs of a South American strain of R. rickettsii. Three groups of dogs were evaluated: group 1 (G1) was inoculated ip with R. rickettsii; group 2 (G2) was infested by R. rickettsii-infected ticks; and the control group (G3) was infested by uninfected ticks. During the study, no clinical abnormalities, Rickettsia DNA or R. rickettsii-reactive antibodies were detected in G3. In contrast, all G1 and G2 dogs developed signs of rickettsial infection, i.e., fever, lethargy, anorexia, ocular lesions, thrombocytopenia, anemia and detectable levels of Rickettsia DNA and R. rickettsii-reactive antibodies in their blood. Rickettsemia started 3-8 days after inoculation or tick infestation and lasted for 3-13 days. Our results indicate that a Brazilian strain of R. rickettsii is pathogenic for dogs, suggesting that canine clinical illness due to R. rickettsii has been unreported in Brazil and possibly in the other South American countries where BSF has been reported among humans.