960 resultados para micro-electron capture detection
Resumo:
The aim of this study was to evaluate the effectiveness of 17% ethylene-diamine-tetra-acetic acid (EDTA) used alone or associated with 2% chlorhexidine gel (CHX) on intracanal medications (ICM) removal. Sixty single-rooted human teeth with fully formed apex were selected. The cervical and middle thirds of each canal were prepared with Gates Glidden drills and rotary files. The apical third was shaped with hand files. The specimens were randomly divided into two groups depending on the ICM used after instrumentation: calcium hydroxide Ca(OH)(2) +CHX or Ca(OH)(2) +sterile saline (SS). After seven days, each group was divided into subgroups according to the protocol used for ICM removal: instrumentation and irrigation either with EDTA, CHX+EDTA, or SS (control groups). All specimens were sectioned and processed for observation of the apical thirds by using scanning electron microscopy. Two calibrated evaluators attributed scores to each specimen. The differences between the protocols for ICM removal were analyzed with Kruskal-Wallis and Mann-Whitney U tests. Friedman and Wilcoxon signed rank tests were used for comparison between the score of debris obtained in each root canal third. Remains of Ca(OH)(2) were found in all specimens independently of the protocol and ICM used (P > 0.05). Seventeen percent EDTA showed the best results in removing ICM when used alone (P < 0.05), particularly in those associated with CHX. It was concluded that the chelating agent 17% EDTA significantly improved the removal of ICM when used alone. Furthermore, the type of the vehicle associated with Ca(OH)(2) also plays a role in the ICM removal.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
To examine the influence of l-arginine supplementation in combination with physical training on mitochondrial biomarkers from gastrocnemius muscle and its relationship with physical performance. Male Wistar rats were divided into four groups: control sedentary (SD), sedentary supplemented with l-arginine (SDLA), trained (TR) and trained supplemented with l-arginine (TRLA). Supplementation of l-arginine was administered by gavage (62.5mg/ml/day/rat). Physical training consisted of 60min/day, 5days/week, 0% grade, speed of 1.2km/h. The study lasted 8weeks. Skeletal muscle mitochondrial enriched fraction as well as cytoplasmic fractions were obtained for Western blotting and biochemical analyses. Protein expressions of transcriptor coactivator (PGC-1α), transcriptor factors (mtTFA), ATP synthase subunit c, cytochrome oxidase (COXIV), constitutive nitric oxide synthases (eNOS and nNOS), Cu/Zn-superoxide dismutase (SOD) and manganese-SOD (Mn-SOD) were evaluated. We also assessed in plasma: lipid profile, glycemia and malondialdehyde (MDA) levels. The nitrite/nitrate (NOx(-)) levels were measured in both plasma and cytosol fraction of the gastrocnemius muscle. 8-week l-arginine supplementation associated with physical training was effective in promoting greater tolerance to exercise that was accompanied by up-regulation of the protein expressions of mtTFA, PGC-1α, ATP synthase subunit c, COXIV, Cu/Zn-SOD and Mn-SOD. The upstream pathway was associated with improvement of NO bioavailability, but not in NO production since no changes in nNOS or eNOS protein expressions were observed. This combination would be an alternative approach for preventing cardiometabolic diseases given that in overt diseases a profound impairment in the physical performance of the patients is observed.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
Glass-ceramics are prepared by controlled separation of crystal phases in glasses, leading to uniform and dense grain structures. On the other hand, chemical leaching of soluble crystal phases yields porous glass-ceramics with important applications. Here, glass/ceramic interfaces of niobo-, vanado- and titano-phosphate glasses were studied by micro-Raman spectroscopy, whose spatial resolution revealed the multiphase structures. Phase-separation mechanisms were also determined by this technique, revealing that interface composition remained unchanged as the crystallization front advanced for niobo- and vanadophosphate glasses (interface-controlled crystallization). For titanophosphate glasses, phase composition changed continuously with time up to the equilibrium composition, indicating a spinodal-type phase separation.
Resumo:
This paper proposes a methodology for spectrophotometric determination of hexamethylenetetramine (HMT) by using chromotropic acid in a phosphoric acid media employing a domestic microwave oven as a source of heating. The reddish-purple soluble product is quantitatively formed after 30 s of irradiation and obeys the Beer´s law in the range between 0.1-1.2 mg L-1 HMT (r = 0.99925). The method was applied successfully in commercial pharmaceutical preparations containing dyes in their composition. The results showed that the method proposed is feasible for simplicity, speed, low cost, precision and accuracy when compared with United States Pharmacopeia official method.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
This in situ study investigated, using scanning electron microscopy, the effect of stimulated saliva on the enamel surface of bovine and human substrates submitted to erosion followed by brushing abrasion immediately or after one hour. During 2 experimental 7-day crossover phases, 9 previously selected volunteers wore intraoral palatal devices, with 12 enamel specimens (6 human and 6 bovine). In the first phase, the volunteers immersed the device for 5 minutes in 150 ml of a cola drink, 4 times a day (8h00, 12h00, 16h00 and 20h00). Immediately after the immersions, no treatment was performed in 4 specimens (ERO), 4 other specimens were immediately brushed (0 min) using a fluoride dentifrice and the device was replaced into the mouth. After 60 min, the other 4 specimens were brushed. In the second phase, the procedures were repeated but, after the immersions, the volunteers stimulated the salivary flow rate by chewing a sugar-free gum for 30 min. Enamel superficial alterations of all specimens were then evaluated using a scanning electron microscope. Enamel prism core dissolution was seen on the surfaces submitted to erosion, while on those submitted to erosion and to abrasion (both at 0 and 60 min) a more homogeneous enamel surface was observed, probably due to the removal of the altered superficial prism layer. For all the other variables - enamel substrate and salivary stimulation -, the microscopic pattern of the enamel specimens was similar.
Resumo:
Dental roots that have been exposed to the oral cavity and periodontal pocket environment present superficial changes, which can prevent connective tissue reattachment. Demineralizing agents have been used as an adjunct to the periodontal treatment aiming at restoring the biocompatibility of roots. OBJECTIVE: This study compared four commonly used demineralizing agents for their capacity of removing smear layer and opening dentin tubules. METHODS: Fifty fragments of human dental roots previously exposed to periodontal disease were scaled and randomly divided into the following groups of treatment: 1) CA: demineralization with citric acid for 3 min; 2) TC-HCl: demineralization with tetracycline-HCl for 3 min; 3) EDTA: demineralization with EDTA for 3 min; 4) PA: demineralization with 37% phosphoric acid for 3 min; 5) Control: rubbing of saline solution for 3 min. Scanning electron microscopy was used to check for the presence of residual smear layer and for measuring the number and area of exposed dentin tubules. RESULTS: Smear layer was present in 100% of the specimens from the groups PA and control; in 80% from EDTA group; in 33.3% from TC-HCl group and 0% from CA group. The mean numbers of exposed dentin tubules in a standardized area were: TC-HCl=43.8±25.2; CA=39.3±37; PA=12.1±16.3; EDTA=4.4±7.5 and Control=2.3±5.7. The comparison showed significant differences between the following pairs of groups: TC-HCl and Control; TC-HCl and EDTA; CA and Control; and CA and EDTA. The mean percentages of area occupied by exposed dentin tubules were: CA=0.12±0.17%; TC-HCl=0.08±0.06%; PA=0.03±0.05%; EDTA=0.01±0.01% and Control=0±0%. The CA group differed significantly from the others except for the TC-HCl group. CONCLUSION: There was a decreasing ability for smear layer removal and dentin tubule widening as follows: AC>TC-HCl>PA>EDTA. This information can be of value as an extra parameter for choosing one of them for root conditioning.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
This study evaluated the effect of specimens' design and manufacturing process on microtensile bond strength, internal stress distributions (Finite Element Analysis - FEA) and specimens' integrity by means of Scanning Electron Microscopy (SEM) and Laser Scanning Confocal Microscopy (LCM). Excite was applied to flat enamel surface and a resin composite build-ups were made incrementally with 1-mm increments of Tetric Ceram. Teeth were cut using a diamond disc or a diamond wire, obtaining 0.8 mm² stick-shaped specimens, or were shaped with a Micro Specimen Former, obtaining dumbbell-shaped specimens (n = 10). Samples were randomly selected for SEM and LCM analysis. Remaining samples underwent microtensile test, and results were analyzed with ANOVA and Tukey test. FEA dumbbell-shaped model resulted in a more homogeneous stress distribution. Nonetheless, they failed under lower bond strengths (21.83 ± 5.44 MPa)c than stick-shaped specimens (sectioned with wire: 42.93 ± 4.77 MPaª; sectioned with disc: 36.62 ± 3.63 MPa b), due to geometric irregularities related to manufacturing process, as noted in microscopic analyzes. It could be concluded that stick-shaped, nontrimmed specimens, sectioned with diamond wire, are preferred for enamel specimens as they can be prepared in a less destructive, easier, and more precise way.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.