988 resultados para 147-895F
Resumo:
The ability of a monkey antiserum to ovine LH to interrupt gestation in monkeys has been established. The antiserum has been shown to neutralize monkey pituitary LH by a number of criteria. The significant increase in serum progesterone level on day 23 of the cycle shown by mated monkeys has been used as an index of pregnancy. Injection of LH antiserum during the first week of missed menses (day 29–31 of cycle or day 18–20 of gestation) causes significant reduction in serum levels of progesterone followed by onset of bleeding which is interpreted as the termination of gestation. The same dose of non-immune serum given to monkeys during the same period does not have any deleterious effect on the progress of pregnancy. The antiserum-treated animals after the termination of gestation, resume cyclicity. Injection of antiserum after day 25 of gestation does not bring about termination of pregnancy. It is suggested that by using antisera raised in humans to ovine LH, this method may be developed as a fertility control measure in humans.
Resumo:
Corporate governance mandates and listing rules identify internal audit functions (IAF) as a central internal control mechanism. External audits are expected to assess the quality of IAF before placing reliance on its work. We provide evidence on the effect of IAF quality and IAF contribution to external audit on audit fees. Using data from a matched survey of both external and internal audits, we extend prior research which is based mainly on internal audits' assessment and conducted predominantly in highly developed markets. We find a positive relationship between IAF quality and audit fees as well as a reduction in audit fees as a result of external auditors' reliance on IAF. The interaction between IAF quality and IAF contribution to external audit suggests that high quality IAF induces greater external auditor reliance on internal auditors' work and thus result in lower external audit fees.
Resumo:
The porphyrogenic drug allylisopropylacetamide, a potent inducer of delta-aminolaevulinate synthetase, specifically increases nucleoplasmic RNA synthesis in rat liver. The drug-mediated increase in nucleoplasmic RNA synthesis is blocked by cycloheximide and haemin, which also inhibit the enzyme induction.
Resumo:
Worldwide population growth and economic agglomeration is driving increasing urban density within larger metropolitan conurbations. Population growth and housing diversity and affordability issues in Queensland have seen an increasing demand for more diverse and higher density development. Under Queensland’s flexible planning regulatory provisions, a level of ‘medium’ to ‘high density’ is being achieved by a focus on fine-grained urban design, low scale development, lot diversity, and delivery of single dwelling products. This for Queensland (and Australia) has been an unprecedented innovation in urban and dwelling design. Dwellings are being delivered on lots with zero regulatory minimum sizes providing for a range of new products including ‘apartments on the ground’. This paper reviews recent and nascent demonstrations of EDQ’s fine-grained urbanism principles, identifiable with historical ‘vernacular suburbanism’. The paper introduces and defines a concept of a ‘natural density’ linking human scale built form with walkability. The paper challenges the notion that (sub)urban development, outside major city centres, needs to be of a higher scale to achieve density and diversity aspirations. ‘Natural density’ provides a means of achieving the increasing demand for more diverse and higher density development.
Resumo:
The quaternary system Sb1bTe1bBi1bSe with small amounts of suitable dopants is of interest for the manufacture of thermoelectric modules which exhibit the Peltier and Seebeck effects. This property could be useful in the production of energy from the thermoelectric effect. Other substances are bismuth telluride (Bi2Te3) and Sb1bTe1bBi and compounds such as ZnIn2Se4. In the present paper the application of computer programs such as MIGAP of Kaufman is used to indicate the stability of the ternary limits of Sb1bTe1bBi within the temperature ranges of interest, namely 273 K to 300 K.
Resumo:
The development and sustained contribution of the Systems Theory Framework to career development theory and practice is well documented in national and international literatures. In addition to its contribution to theory integration, it has added to the growing literature on connecting career theory and practice, in particular for non-Western populations. In addition, it has been the basis of the development of a broad array of constructivist approaches to career counselling, and indeed specific reflective career assessment activities. This article begins with a brief history of the Systems Theory Framework which is then followed by a rationale for its development. The contribution of the Systems Theory Framework to theory and practice is then described prior to concluding comments by the authors.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
Nitrate assimilation in many plants, algae, yeasts and bacteria is mediated by two enzymes, nitrate reductase (EC 1.6.6.2) and nitrite reductase (EC 1.7.7.1). They catalyse the stepwise reduction of nitrate to nitrite and nitrite to ammonia respectively. The nitrite reductase from an industrially important yeast, Candida utilis, has been purified to homogeneity. Purified nitrite reductase is a heterodimer and the molecular masses of the two subunits are 58 and 66 kDa. The native enzyme exhibits a molecular mass of 126 kDa as analysed by gel filtration. The identify of the two subunits of nitrite reductase was confirmed by immunoblotting using antibody for Cucurbita pepo leaf nitrite reductase. The presence of two different sized transcripts coding for the two subunits was confirmed by (a) in vitro translation of mRNA from nitrate-induced C. utilis followed by immunoprecipitation of the in vitro translated products with heterologous nitrite reductase antibody and (b) Northern-blot analysis. The 66 kDa subunit is acidic in nature which is probably due to its phosphorylated status. The enzyme is stable over a range of temperatures. Both subunits can catalyse nitrite reduction, and the reconstituted enzyme, at a higher protein concentration, shows an activity similar to that of the purified enzyme. Each of these subunits has been shown to contain a few unique peptides in addition to a large number of common peptides. Reduced Methyl Viologen has been found to be as effective an electron donor as NADPH in the catalytic process, a phenomenon not commonly seen for nitrite reductases from other systems.
Resumo:
Polyhedral bodies of Bombyx mori nuclear polyhedrosis virus, BmNPV (BGL) isolated from infected silkworms around Bangalore were propagated either in the cultured B. mori cell line, BmN or through infection of larvae. Electron microscopic (EM) observations of the polyhedra revealed an average length of 2 mu m and a height of 0.5 mu m. The purified polyhedra derived virions (PDV) showed several bands in sucrose gradient centrifugation, indicating the multiple nucleocapsid nature of BmNPV. Electron microscopic studies of PDV revealed a cylindrical, rod-shaped nucleocapsid with an average length of 300 nm and a diameter of 35 nm. The genomic DNA from the PDV was characterized by extensive restriction analysis and the genome size was estimated to be 132 kb. The restriction pattern of BmNPV (BGL) resembled that of the prototype strain BmNPV-T3. Distinct differences due to polymorphic sites for restriction enzyme HindIII were apparent between BmNPV (BGL) and the virus isolated from a different part of Karnataka (Dharwad area), BmNPV (DHR).
Resumo:
Chicken riboflavin carrier protein (RCP) is a phosphoglycoprotein present in the egg white and yolk of egg-laying animals and in the sera of laying hens and of estrogenized chicks. The RCP cDNA, encoding a protein of predictedMr27,000, has been cloned into a T7 polymerase-driven vector, and high-level expression was observed on induction with IPTG inEscherichia coli.The protein was largely localized in inclusion bodies when expressed at 37°C but was present in the cytosolic fraction when induced at 22°C. At 37°C, two major bands were detected in whole-cell lysates of the strain expressing the protein. N-terminal sequence analysis indicated that the two proteins represented translated products with and without the pelB leader sequence encoded in the pET20b vector, but both included an additional 10 amino acids generated during cloning procedures. The inclusion body obtained at 37°C, on extraction with detergent, led to preferential solubilization of the protein without the pelB signal sequence. The solubilized recombinant RCP was recognized by polyclonal antisera to native RCP but radioimmunoassay revealed quantitative differences in the epitopes exhibited by the recombinant protein. Thus, sequence-specific monoclonal antibodies to chicken RCP also cross-reacted with the recombinant protein with almost equal efficiency, but antibodies which recognize conformation-dependent epitopes showed relatively reduced cross-reactivity with the recombinant protein. Polyclonal antibodies to recombinant RCP were able to recognize both the native and the denatured RCP. Administration of recombinant RCP antisera to pregnant mice led to embryonic resorption leading to early pregnancy termination. These findings reveal that the recombinant protein will be useful for investigations related to the mechanism of pregnancy termination on immunoneutralization of RCP in mammals, as well as in unraveling folding properties of RCP in terms of its ligand binding and antigenetic determinants exposed at its surface.
Resumo:
Sexually mature male rabbits actively immunized against highly purified ovine LH (oLH) were used as a model system to study the effects of endogenous LH deprivation (and therefore testosterone) on spermatogenesis as well as pituitary FSH secretion. Immunization against oLH generated antibody titres capable of cross-reacting and neutralizing rabbit LH and this resulted in a significant reduction (P<0.01) in serum testosterone levels by 2-4 weeks of immunization. A significant increase in circulating FSH concentration (from a basal level of similar to 1 ng to 60-100 ng/ml; P<0.01) was observed within 4-6 weeks of immunization, perhaps a consequence of the negative feedback effect of the lack of testosterone. The effect of LH deprivation on spermatogenesis assessed by DNA flow cytometry and histological analyses of testicular biopsy tissue revealed that lack of testosterone primarily results in a rapid reduction and complete absence of round (1C) and elongated (HC) spermatids. The immediate effect of LH/testosterone deprivation thus appears to be at the step of meiotic transformation of primary spermatocytes (4C) to 1C. A significant reduction (>80%; P<0.01) in the 4C population and a relative accumulation (>90%; P<0.01) in spermatogonia (2C) was also observed, suggesting a need for testosterone during the transformation of 2C to 1C. In all but one of the rabbits, both qualitative and quantitative recovery in spermatogenesis occurred during the recovery phase, even at a time when only a marginal increase in serum testosterone (compared with the preimmunization) levels was observed as a result of a rapid decline in the cross-reactive antibody titres. These results clearly show that LH/testosterone deprivation in addition to primarily affecting the meiotic step also regulates the conversion of 2C to 4C during spermatogenesis.
Resumo:
The unknown future is a challenge to educators in preparing young people for life post school. While history can be said to repeat itself, the reality is that each generation is faced with new challenges and threats. Therefore, the challenge for contemporary schooling is to prepare students to live in a fast paced, complex world where threats such as terrorism, cyberbullying and depleted resources are juggled with high stakes testing and curriculum accountability. This presentation draws on the notion of a future of supercomplexity while critically examining current pastoral care delivery in schools to develop a new model of practice in preparing students for an unknown future.
Resumo:
Hypokinesia, rigidity, tremor, and postural instability are the cardinal symptoms of Parkinson s disease (PD). Since these symptoms are not specific to PD the diagnosis may be uncertain in early PD. Etiology and pathogenesis of PD remain unclear. There is no neuroprotective therapy. Genetic findings are expected to reveal metabolic routes in PD pathogenesis and thereby eventually lead to therapeutic innovations. In this thesis, we first aimed to study the usefulness and accuracy of 123I-b-CIT SPECT in the diagnosis of PD in a consecutive clinic-based material including various movement disorders. We subsequently a genetic project to identify genetic risk factors for sporadic PD using a candidate gene approach in a case-control setting including 147 sporadic PD patients and 137 spouse controls. Dopamine transporter imaging by 123I-b-CIT SPECT could distinguish PD from essential tremor, drug-induced parkinsonism, dystonia and psychogenic parkinsonism. However, b-CIT uptake in Parkinson plus syndromes (PSP and multiple system atrophy) and dementia with Lewy bodies was not significantly different from PD. 123I-b-CIT SPECT could not reliably differentiate PD from vascular parkinsonism. 123I-b-CIT SPECT was 100% sensitive and specific in the diagnosis of PD in patients younger than 55 years but less specific in older patients, due to differential distribution of the above conditions in the younger and older age groups. 123I-b-CIT SPECT correlated with symptoms and detected bilateral nigrostriatal defect in patients whose PD was still in unilateral stage. Thus, in addition to as a differential diagnostic aid, 123I-b-CIT SPECT may be used to detect PD early, even pre-symptomatically in at-risk individuals. 123I-b-CIT SPECT was used to aid in the collection of patients to the genetic studies. In the genetic part of this thesis we found an association between PD and a polymorphic CAG-repeat in POLG1 gene encoding the catalytic subunit of mitochondrial polymerase gamma. The CAG-repeat encodes a polyglutamine tract (polyQ), the two most common lengths of which are 10Q (86-90%) and 11Q. In our Finnish material, the rarer non-10Q or non-11Q length variants (6Q-9Q, 12Q-14Q, 4R+9Q) were more frequent in patients than in spouse controls (10% vs. 3.5 %, p=0.003), or population controls (p=0.001). Therefore, we performed a replication study in 652 North American PD patients and 292 controls. Non-10/11Q alleles were more common in the US PD patients compared to the controls but the difference did not reach statistical significance (p=0.07). This larger data suggested our original definition of variant length allele might need reconsideration. Most previous studies on phenotypic effects of POLG1 polyQ have defined 10Q as the only normal allele. Non-10Q alleles were significantly more common in patients compared to the controls (17.3% vs. 12.3 %, p= 0.005). This association between non-10Q length variants and PD remained significant when compared to a larger set of 1541 literature controls (p=0.00005). In conclusion, POLG1 polyQ alleles other than 10Q may predispose to PD. We did not find association between PD and parkin or DJ-1, genes underlying autosomal recessive parkinsonism. The functional Val158Met polymorphism, which affects the catalytic effect of COMT enzyme, and another coding polymorphism in COMT were not associated with PD in our patient material. The APOE e2/3/4 polymorphism modifies risk for Alzheimer s disease and prognosis of for example brain trauma. APOE promoter and enhancer polymorphisms 219G/T and +113G/C, and APOE e3 haplotypes, have also been shown to modify the risk of Alzheimer s disease but not reported in PD. No association was found between PD and APOE e2/3/4 polymorphism, the promoter or enhancer polymorphisms, or the e3 haplotypes.
Resumo:
The aim of the study was to evaluate gastrointestinal (GI) complications after kidney transplantation in the Finnish population. The adult patients included underwent kidney transplantation at Helsinki University Central Hospital in 1990-2000. Data on GI complications were collected from the Finnish Kidney Transplantation Registry, patient records and from questionnaires sent to patients. Helicobacter pylori IgG and IgA antibodies were measured from 500 patients before kidney transplantation and after a median 6.8-year follow up. Oesophagogastroduodenoscopy with biopsies was performed on 46 kidney transplantation patients suffering from gastroduodenal symptoms and 43 dyspeptic controls for studies of gastroduodenal cytomegalovirus (CMV) infection. Gallbladder ultrasound was performed on 304 patients after a median of 7.4 years post transplantation. Data from these 304 patients were also collected on serum lipids, body mass index and the use of statin medication. Severe GI complications occurred in 147 (10%) of 1515 kidney transplantations, 6% of them fatal after a median of 0.93 years. 51% of the complications occurred during the first post transplantation year, with highest incidence in gastroduodenal ulcers and complications of the colon. Patients with GI complications were older and had more delayed graft function and patients with polycystic kidney disease had more GI complications than the other patients. H.pylori seropositivity rate was 31% and this had no influence on graft or patient survival. 29% of the H.pylori seropositive patients seroreverted without eradication therapy. 74% of kidney transplantation patients had CMV specific matrix protein pp65 or delayed early protein p52 positive findings in the gastroduodenal mucosa, and 53% of the pp65 or p52 positive patients had gastroduodenal erosions without H.pylori findings. After the transplantation 165 (11%) patients developed gallstones. A biliary complication including 1 fatal cholecystitis developed in 15% of the patients with gallstones. 13 (0.9%) patients had pancreatitis. Colon perforations, 31% of them fatal, occurred in 16 (1%) patients. 13 (0.9%) developed a GI malignancy during the follow up. 2 H.pylori seropositive patients developed gastroduodenal malignancies during the follow up. In conclusion, severe GI complications usually occur early after kidney transplantation. Colon perforations are especially serious in kidney transplantation patients and colon diverticulosis and gallstones should be screened and treated before transplantation. When found, H.pylori infection should also be treated in these patients.