874 resultados para fruit availability
Resumo:
Background. Similar to parent support in the home environment, teacher support at school may positively influence children's fruit and vegetable (FV) consumption. This study assessed the relationship between teacher support for FV consumption and the FV intake of 4th and 5th grade students in low-income elementary schools in central Texas. Methods. A secondary analysis was performed on baseline data collected from 496 parent-child dyads during the Marathon Kids study carried out by the Michael & Susan Dell Center for Healthy Living at the University of Texas School of Public Health. A hierarchical linear regression analysis adjusting for key demographic variables, parent support, and home FV availability was conducted. In addition, separate linear regression models stratified by quartiles of home FV availability were conducted to assess the relationship between teacher support and FV intake by level of home FV availability. Results. Teacher support was not significantly related to students' FV intake (p = .44). However, the interaction of teacher support and home FV availability was positively associated with students' FV consumption (p < .05). For students in the lowest quartile of home FV availability, teacher support accounted for approximately 6% of the FV intake variance (p = .02). For higher levels of FV availability, teacher support and FV intake were not related. Conclusions. For lower income elementary school-aged children with low FV availability at home, greater teacher support may lead to modest increases in FV consumption.^
Resumo:
Commonly recommended plant sources of provitamin A, such as dark green leafy vegetables, are not acceptable in many population groups. The objective of this study was to identify other indigenous foods that may be effectively promoted to alleviate vitamin A deficiency (VAD) and to gather information relevant to identification, production, acquisition, and consumption of foods relevant to a food-based VAD prevention strategy in the Federated States of Micronesia. An ethnographic study on edible pandanus cultivars, involving key informant interviews and observation was carried out. Analyses revealed a great range in carotenoid content. Several orange-coloured pandanus cultivars, all highly acceptable, contained high levels of carotenoid, almost meeting daily requirements in usual consumption patterns, whereas light yellow-coloured cultivars contained low levels. Availability has decreased substantially in recent years due to increased consumption of imported foods and general neglect of indigenous foods. High-carotenoid pandanus should be promoted for general enjoyment and health benefits.
Resumo:
BACKGROUND: The Pro Children Eating Habits Questionnaire has been evaluated as a valid and reliable tool in Europe to measure determinants of fruit and vegetable intake for children; however, it has not been validation for United States populations. The purpose of this study was to (1) assess the reliability and discrimination validity of fruit and vegetable correlates for the Pro Children Eating Habits Questionnaire; (2) investigate the predictive validity of determinants of fruit and vegetable consumption for multi-ethnic elementary school children; and, (3) to assess the association of social determinants with fruit and vegetable consumption. METHODS: One hundred and thirty elementary school students from the 3rd and 5th grades completed this cross-sectional study. RESULTS: Fruit and vegetable determinants, had satisfactory internal consistencies. No differences were found between the test and the retest for the individual questions with the exception of the question for mean perceived vegetable intake. The discriminatory validity indicated the questionnaire could show differences across grade and gender levels for barriers of fruit and vegetables but not for other factors. Grade together with gender explained barriers to eating fruit and vegetables. Greater availability of fruit in the home and school was associated with higher frequency of consumption. CONCLUSIONS: The results of this study indicate the Pro-Children Eating Habits Questionnaire may be a reliable and valid tool for assessing fruit and vegetable consumption of children in the United States.
Resumo:
Soil tillage with chisel ploughing is the conventional soil management system in chestnut stands for fruit production in Northern Portugal. A study was developed to assess the effects of three soil management systems on in situ soil N mineralization dynamics, tree nutrition status and fruit productivity, in a 50-yr old chestnut stand. The treatments were: conventional tillage with a chisel ploughing twice a year (CT), no-tillage with rainfed improved pasture with leguminous and grasses plants (NIP), and no-tillage with spontaneous herbaceous vegetation - natural pasture (NP). The CT treatment showed a strong increase of the soil N mineral concentration following soil disturbance by tillage, but the cumulative net N mineralized along the year was significantly lower (51.8 kg ha-1) than in the NIP (85.1 kg ha-1) treatment. The NP treatment (65.9 kg ha-1) did not cause a reduction in the soil N mineralization when compared to the CT treatment. The mineralization rate (g mineralized N kg-1 total N) in 2004 was about 26, 30 and 38 in the treatments CT, NP and NIP, respectively. Treatments showed different soil N dynamics, the proportion of mineralized NO3--N being lower in the NP (10-48%) than in CT and NIP treatments (53-74%). Our study indicates that no-tillage systems improve the tree nutrition status and enhance productivity
Resumo:
Scarcity of freshwater due to recurrent drought threatens the sustainable crop production in semi-arid regions of Ethiopia. Deficit irrigation is thought to be one of the promising strategies to increase water use efficiency (WUE) under scarce water resources. A study was carried out to investigate the effect of alternate furrow irrigation (AFI), deficit irrigation (DI) and full irrigation (FI) on marketable fruit yield, WUE and physio-chemical quality of four fresh-market tomato cultivars (Fetan, Chali, Cochoro and ARP Tomato d2) in 2013 and 2014. The results showed that marketable yield, numbers of fruits per plant and fruit size were not significantly affected by AFI and DI irrigations. WUE under AFI and DI increased by 36.7% and 26.1%, respectively with close to 30% irrigation water savings achieved. A different response of cultivars to irrigation treatments was found for marketable yield, number of fruits and fruit size, WUE, total soluble solids (TSS) of the fruit juice, titratable acids (TA) and skin thickness. Cochoro and Fetan performed well under both deficit irrigation treatments exhibited by bigger fruit size which led to higher WUE. ARP Tomato d2 showed good yields under well-watered conditions. Chali had consistently lower marketable fruit yield and WUE. TSS and TA tended to increase under deficit irrigation; however, the overall variations were more explained by irrigation treatments than by cultivars. It was shown that AFI is a suitable deficit irrigation practice to increase fresh yield, WUE and quality of tomato in areas with low water availability. However, AFI requires suitable cultivars in order to exploit its water saving potential.
Resumo:
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.
Resumo:
Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.
Resumo:
In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.
Resumo:
The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.
Resumo:
The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.
Resumo:
Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.
Resumo:
Information on fruits and vegetables consumption in Brazil in the three levels of dietary data was analyzed and compared. Data about national supply came from Food Balance Sheets compiled by the FAO; household availability information was obtained from the Brazilian National Household Budget Survey (HBS); and actual intake information came from a large individual dietary intake survey that was representative of the adult population of São Paulo city. All sources of information were collected between 2002 and 2003. A subset of the HBS, representative of São Paulo city, was used in our analysis in order to improve the quality of the comparison with actual intake data. The ratio of national supply to household availability of fruits and vegetables was 2.6 while the ratio of national supply to actual intake was 4.0. The discrepancy ratio in the comparison between household availability and actual intake was smaller, 1.6. While the use of supply and availability data has advantages, as lower cost, must be taken into account that these sources tend to overestimate actual intake of fruits and vegetables.
Resumo:
This study aims to estimate an adult-equivalent scale for calorie requirements and to determine the differences between adult-equivalent and per capita measurements of calorie availability in the Brazilian population. The study used data from the 2002-2003 Brazilian Household Budget Survey. The calorie requirement for a reference adult individual was based on the mean requirements for adult males and females (2,550kcal/day). The conversion factors were defined as the ratios between the calorie requirements for each age group and gender and that of the reference adult. The adult-equivalent calorie availability levels were higher than the per capita levels, with the largest differences in rural and low-income households. Differences in household calorie availability varied from 22kcal/day (households with adults and an adolescent) to 428kcal/day (households with elderly individuals), thus showing that per capital measurements can underestimate the real calorie availability, since they overlook differences in household composition.