872 resultados para Latex-fruit-pollen ayndrome


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Tetratheca juncea Smith (Tremandraceae) has undergone a range contraction of approx. 50 km in the last 100 years and is now listed as a vulnerable sub-shrub restricted to the central and north coast regions of New South Wales, Australia. There are approx. 250 populations in a 110 km north-south distribution and populations are usually small with fewer than 50 plants/clumps. The reproductive ecology of the species was studied to determine why seed-set is reportedly rare. Flowers are bisexual, odourless and nectarless. Flowers are presented dependentally and there are eight stamens recurved around the pistil. Anthers are poricidal, contain viable pollen and basally contain a deep-red tapetal fluid that is slightly oily. Thus flowers are presented for buzz pollinators, although none were observed at flowers during our study. The species was found to be facultatively xenogamous with only one in 50 glasshouse flowers setting seed autogamously, i.e. without pollinator assistance. Field studies revealed fertile fruit in 24 populations but production varied significantly across sites from exceedingly low (0.6 fruits per plant clump) to low (17 fruits per plant clump). Fruit-set ranged from 0 to 65%, suggesting that pollen vectors exist or that autogamy levels in the field are variable and higher than glasshouse results. Fruit production did not vary with population size, although in three of the five populations in the south-west region more than twice as much fruit was produced as in populations elsewhere. A moderately strong relationship between foliage volume and fruit : flower ratios suggests that bigger plants may be more attractive than smaller plants to pollinators. A review of Tetratheca pollination ecology revealed that several species are poorly fecund and pollinators are rare. The habitat requirements for Tetratheca, a genus of many rare and threatened species, is discussed. (C) 2003 Annals of Botany Company.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In order to reconstruct regional vegetation changes and local conditions during the fen-bog transition in the Borsteler Moor (northwestern Germany), a sediment core covering the period between 7.1 and 4.5 cal kyrs BP was palynologically in vestigated. The pollen diagram demonstrates the dominance of oak forests and a gradual replacement of trees by raised bog vegetation with the wetter conditions in the Late Atlantic. At ~ 6 cal kyrs BP, the non-pollen palynomorphs (NPP) demonstrate the succession from mesotrophic conditions, clearly indicated by a number of fungal spore types, to oligotrophic conditions, indicated by Sphagnum spores, Bryophytomyces sphagni, and testate amoebae Amphitrema, Assulina and Arcella, etc. Four relatively dry phases during the transition from fen to bog are clearly indicated by the dominance of Calluna and associated fungi as well as by the increase of microcharcoal. Several new NPP types are described and known NPP types are identified. All NPP are discussed in the context of their palaeoecological indicator values.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The World Health Organization (WHO, 2005) recommends consumption of fruits and vegetables as part of a healthy diet with daily recommendation of 5 servings or at least 400 g per day. Fruits and vegetables are good sources of vitamins, minerals, antioxidants, and fiber. Papaya fruit is known for his high nutrient and fiber content, and with few exceptions, it is generally consumed ripe due to its characteristic flavor and aroma. Digestion improvement has been attributed to consumption of papaya; this we speculate is attributed to the fiber content and proteolytic enzymes associated with this highly nutritious fruit. However, research is lacking that evaluates the impact of papaya fruit on human digestion. Papain is a proteolytic enzyme generally extracted from the latex of unripe papaya. Previous research has focused on evaluating papain activity from the latex of different parts of the plant; however there are no reports about papain activity in papaya pulp through fruit maturation. The activity of papain through different stages of ripeness of papaya and its capacity of dislodging meat bolus in an in vitro model was addressed. The objective of this study was to investigate whether papain activity and fiber content are responsible for the digestive properties attributed to papaya and to find a processing method that preserves papaya health properties with minimal impact on flavor. Our results indicated that papain was active at all maturation stages of the fruit. Ripe papaya pulp displayed the highest enzyme activity and also presented the largest meat bolus displacement. The in vitro digestion study indicated that ripe papaya displayed the highest protein digestibility; this is associated with proteolytic enzymes still active at the acidity of the stomach. Results from the in vitro fermentation study indicated that ripe papaya produced the highest amount of Short Chain Fatty Acids SCFA of the three papaya substrates (unripe, ripe, and processed). SCFA are the most important product of fermentation and are used as indicators of the amount of substrate fermented by microorganisms in the colon. The combination of proteolytic enzymes and fiber content found in papaya make of this fruit not only a potential digestive aid, but also a good source of SCFA and their associated potential health benefits. Irradiation processing had minimal impact on flavor compounds of papaya nectar. However, processed papaya experienced the lowest protein digestibility and SCFA production among the papaya substrates. Future research needs to explore new processing methods for papaya that minimize the detrimental impact on enzyme activity and SCFA production.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Strawberry fruits are highly appreciated worldwide due to their pleasant flavor and aroma and to the health benefits associated to their consumption. An important part of these properties is due to their content in secondary metabolites, especially phenolic compounds, of which flavonoids are the most abundant in the strawberry fruit. Although the flavonoid biosynthesis pathway is uncovered, little is known about its regulation. The strawberry Fra a (Fra) genes constitute a large family of homologs of the major birch pollen allergen Bet v 1 and for which no equivalents exist in Arabidopsis. Our group has shown that Fra proteins are involved in the formation of colored compounds in strawberries (Muñoz et al., 2010), which mainly depends on the production of certain flavonoids; that they are structurally homologs to the PYR/PYL/RCAR Arabidopsis ABA receptor, and that they are able to bind flavonoids (Casañal et al., 2013). With these previous results, our working hypothesis is that the Fra proteins are involved in the regulation of the flavonoids pathway. They would mechanistically act as the ABA receptor, binding a protein interactor and a ligand to regulate a signaling cascade and/or act as molecular carriers. The main objective of this research is to characterize the Fra family in strawberry and gain insight into their role in the flavonoid metabolism. By RNAseq expression analysis in ripening fruits we have identified transcripts for 10 members of the Fra family. Although expressed in all tissues analyzed, each family member presents a unique pattern of expression, which suggests functional specialization for each Fra protein. Then, our next approach was to identify the proteins that interact with Fras and their ligands to gain knowledge on the role that these proteins play in the flavonoids pathway. To identify the interacting partners of Fras we have performed a yeast two hybrid (Y2H) screening against cDNA libraries of strawberry fruits at the green and red stages. A protein that shares a 95% homology to the Heat stress transcription factor A-4-C like of Fragaria vesca (HSA4C) interacts specifically with Fra1 and not with other family members, which suggests functional diversification of Fra proteins in specific signaling pathways. The Y2H screening is not yet saturated, so characterization of other interacting proteins with other members of the Fra family will shed light on the functional diversity within this gene family. This research will contribute to gain knowledge on how the flavonoid pathway, and hence, the fruit ripening, is regulated in strawberry; an economically important crop but for which basic research is still very limited. References: Muñoz, C, et al. (2010). The Strawberry Fruit Fra a Allergen Functions in Flavonoid Biosynthesis. Molecular Plant, 3(1): 113–124. Casañal, A, et al (2013). The Strawberry Pathogenesis-related 10 (PR-10) Fra a Proteins Control Flavonoid Biosynthesis by Binding Metabolic Intermediates. Journal of Biological Chemistry, 288(49): 35322–35332.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The lack of pear-compatible rootstocks in Brazil calls for the application of classical genetic techniques. Therefore, in order to obtain select suitable material, the search for genetic segregation must be continuous, being used as alternative scion cultivars. This study aims to assess fruit set, number of seeds, fruit weight and fruit diameter according to crosses between pear cultivars. The trial was carried out from September 2008 to February 2009 in a commercial orchard in the city of Vacaria/RS, Brazil. For the pollination process, pollen was extracted from flowers at full-white stage in the same orchard. The cultivars used were 'Packham's Triumph' and 'Clapps Favorite'. The crossings were defined as: open pollination; selfpollination of 'Packham's Triumph' and 'Packham's Triumph' × 'Clapps Favorite'. The pollinations were done manually in flowers at full-white stage, which were opened, emasculated and then pollinated. Each pollinated flower was then isolated with a fine nylon bag. Open pollination and cross pollination between 'Packham's Triumph' × 'Clapps Favorite' provided higher fruit set (17 and 18%, respectively). Fruit weight and diameter did not differ between treatments. Open pollination provided fruits with a higher number of seeds.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hevea brasiliensis is a native species of the Amazon Basin of South America and the primary source of natural rubber worldwide. Due to the occurrence of South American Leaf Blight disease in this area, rubber plantations have been extended to suboptimal regions. Rubber tree breeding is time-consuming and expensive, but molecular markers can serve as a tool for early evaluation, thus reducing time and costs. In this work, we constructed six different cDNA libraries with the aim of developing gene-targeted molecular markers for the rubber tree. A total of 8,263 reads were assembled, generating 5,025 unigenes that were analyzed; 912 expressed sequence tags (ESTs) represented new transcripts, and two sequences were highly up-regulated by cold stress. These unigenes were scanned for microsatellite (SSR) regions and single nucleotide polymorphisms (SNPs). In total, 169 novel EST-SSR markers were developed; 138 loci were polymorphic in the rubber tree, and 98 % presented transferability to six other Hevea species. Locus duplication was observed in H. brasiliensis and other species. Additionally, 43 SNP markers in 13 sequences that showed similarity to proteins involved in stress response, latex biosynthesis and developmental processes were characterized. cDNA libraries are a rich source of SSR and SNP markers and enable the identification of new transcripts. The new markers developed here will be a valuable resource for linkage mapping, QTL identification and other studies in the rubber tree and can also be used to evaluate the genetic variability of other Hevea species, which are valuable assets in rubber tree breeding.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Relationships among floral biology, floral micromorphology and pollinator behaviour in bird-pollinated orchids are important issues to understand the evolution of the huge flower diversity within Orchidaceae. We aimed to investigate floral mechanisms underlying the interaction with pollinators in two hummingbird-pollinated orchids occurring in the Atlantic forest. We assessed floral biology, nectar traits, nectary and column micromorphologies, breeding systems and pollinators. In both species, nectar is secreted by lip calli through spaces between the medial lamellar surfaces of epidermal cells. Such form of floral nectar secretion has not been previously described. Both species present functional protandry and are self-compatible yet pollinator-dependent. Fruit sets in hand-pollination experiments were more than twice those under natural conditions, evidencing pollen limitation. The absence of fruit set in interspecific crosses suggests the existence of post-pollination barriers between these synchronopatric species. In Elleanthus brasiliensis, fruits resulting from cross-pollination and natural conditions were heavier than those resulting from self-pollination, suggesting advantages to cross-pollination. Hummingbirds pollinated both species, which share at least one pollinator species. Species differences in floral morphologies led to distinct pollination mechanisms. In E. brasiliensis, attachment of pollinaria to the hummingbird bill occurs through a lever apparatus formed by an appendage in the column, another novelty to the knowledge of orchids. In E. crinipes, pollinaria attachment occurs by simple contact with the bill during insertion into the flower tube, which fits tightly around the bill. The novelties described here illustrate the overlooked richness in ecology and morphophysiology in Orchidaceae. This article is protected by copyright. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.