837 resultados para INCREASES FRUIT
Exercise Increases Pancreatic β-cell Viability In A Model Of Type 1 Diabetes Through Il-6 Signaling.
Resumo:
Type 1 diabetes (T1D) is provoked by an autoimmune assault against pancreatic β cells. Exercise training enhances β-cell mass in T1D. Here, we investigated how exercise signals β cells in T1D condition. For this, we used several approaches. Wild-type and IL-6 knockout (KO) C57BL/6 mice were exercised. Afterward, islets from control and trained mice were exposed to inflammatory cytokines (IL-1β plus IFN-γ). Islets from control mice and β-cell lines (INS-1E and MIN6) were incubated with serum from control or trained mice or medium obtained from 5-aminoimidazole-4 carboxamide1-β-d-ribofuranoside (AICAR)-treated C2C12 skeletal muscle cells. Subsequently, islets and β cells were exposed to IL-1β plus IFN-γ. Proteins were assessed by immunoblotting, apoptosis was determined by DNA-binding dye propidium iodide fluorescence, and NO(•) was estimated by nitrite. Exercise reduced 25, 75, and 50% of the IL-1β plus IFN-γ-induced iNOS, nitrite, and cleaved caspase-3 content, respectively, in pancreatic islets. Serum from trained mice and medium from AICAR-treated C2C12 cells reduced β-cell death, induced by IL-1β plus IFN-γ treatment, in 15 and 38%, respectively. This effect was lost in samples treated with IL-6 inhibitor or with serum from exercised IL-6 KO mice. In conclusion, muscle contraction signals β-cell survival in T1D through IL-6.-Paula, F. M. M., Leite, N. C., Vanzela, E. C., Kurauti, M. A., Freitas-Dias, R., Carneiro, E. M., Boschero, A. C., and Zoppi, C. C. Exercise increases pancreatic β-cell viability in a model of type 1 diabetes through IL-6 signaling.
Acupuncture Increases The Diameter And Reorganisation Of Collagen Fibrils During Rat Tendon Healing.
Resumo:
Our previous study showed that electroacupuncture (EA) increases the concentration and reorganisation of collagen in a rat model of tendon healing. However, the ultrastructure of collagen fibrils after acupuncture is unknown. To assess the effect of acupuncture protocols on the ultrastructure of collagen fibrils during tendon healing. Sixty-four rats were divided into the following groups: non-tenotomised (normal group), tenotomised (teno group), tenotomised and subjected to manual acupuncture at ST36 (ST36 group), BL57 (BL57 group) and ST36+BL57 (SB group) and EA at ST36+BL57 (EA group). The mass-average diameter (MAD) and the reorganisation of collagen fibril diameters were determined during the three phases of tendon healing (at 7, 14 and 21 days). The MAD increased during the three phases of healing in the SB group. In the EA group, MAD increased initially but was reduced at day 21. The reorganisation of collagen fibrils was improved in the EA and SB groups at days 14 and 21, respectively. EA at day 21 appeared to reduce the reorganisation. These results indicate that the use of EA up to day 14 and manual acupuncture at ST36+BL57 up to day 21 improve the ultrastructure of collagen fibrils, indicating strengthening of the tendon structure. These data suggest a potential role for acupuncture in rehabilitation protocols.
Resumo:
Nitric oxide (NO)-mediated vasodilation plays a key role in gastric mucosal defense, and NO-donor drugs may protect against diseases associated with gastric mucosal blood flow (GMBF) deficiencies. In this study, we used the ex vivo gastric chamber method and Laser Doppler Flowmetry to characterize the effects of luminal aqueous NO-donor drug S-nitroso-N-acetylcysteine (SNAC) solution administration compared to aqueous NaNO2 and NaNO3 solutions (pH 7.4) on GMBF in Sprague-Dawley rats. SNAC solutions (600 μM and 12 mM) led to a rapid threefold increase in GMBF, which was maintained during the incubation of the solutions with the gastric mucosa, while NaNO2 or NaNO3 solutions (12 mM) did not affect GMBF. SNAC solutions (600 μM and 12 mM) spontaneously released NO at 37 °C at a constant rate of 0.3 or 14 nmol·mL-1·min-1, respectively, while NaNO2 (12 mM) released NO at a rate of 0.06 nmol·mL-1·min-1 and NaNO3 (12 mM) did not release NO. These results suggest that the SNAC-induced GMBF increase is due to their higher rates of spontaneous NO release compared to equimolar NaNO2 solutions. Taken together, our data indicate that oral SNAC administration is a potential approach for gastric acid-peptic disorder prevention and treatment.
Resumo:
Reduction in sirtuin 1 (Sirt-1) is associated with extracellular matrix (ECM) accumulation in the diabetic kidney. Theobromine may reduce kidney ECM accumulation in diabetic rats. In the current study, we aimed to unravel, under diabetic conditions, the mechanism of kidney ECM accumulation induced by a reduction in Sirt-1 and the effect of theobromine in these events. In vitro, we used immortalized human mesangial cells (iHMCs) exposed to high glucose (HG; 30 mM), with or without small interfering RNA for NOX4 and Sirt-1. In vivo, spontaneously hypertensive rats (SHR) were rendered diabetic by means of streptozotocin and studied after 12 wk. The effects of treatment with theobromine were investigated under both conditions. HG leads to a decrease in Sirt-1 activity and NAD(+) levels in iHMCs. Sirt-1 activity could be reestablished by treatment with NAD(+), silencing NOX4, and poly (ADP-ribose) polymerase-1 (PARP-1) blockade, or with theobromine. HG also leads to a low AMP/ATP ratio, acetylation of SMAD3, and increased collagen IV, which is prevented by theobromine. Sirt-1 or AMPK blockade abolished these effects of theobromine. In diabetic SHR, theobromine prevented increases in albuminuria and kidney collagen IV, reduced AMPK, elevated NADPH oxidase activity and PARP-1, and reduced NAD(+) levels and Sirt-1 activity. These results suggest that in diabetes mellitus, Sirt-1 activity is reduced by PARP-1 activation and NAD(+) depletion due to low AMPK, which increases NOX4 expression, leading to ECM accumulation mediated by transforming growth factor (TGF)-β1 signaling. It is suggested that Sirt-1 activation by theobromine may have therapeutic potential for diabetic nephropathy.
Resumo:
In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.
Resumo:
The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.
Resumo:
The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.
Resumo:
OBJECTIVES: We investigated the influence of sildenafil on cardiac contractility and diastolic relaxation and examined the distribution of phosphodiesterase-5 in the hearts of hypertensive rats that were treated with by NG-nitro-L-arginine methyl ester (L-NAME). METHODS: Male Wistar rats were treated with L-NAME and/or sildenafil for eight weeks. The Langendorff method was used to examine the effects of sildenafil on cardiac contractility and diastolic relaxation. The presence and location of phosphodiesterase-5 and phosphodiesterase-3 were assessed by immunohistochemistry, and cGMP plasma levels were measured by ELISA. RESULTS: In isolated hearts, sildenafil prevented the reduction of diastolic relaxation (dP/dt) that was induced by L-NAME. In addition, phosphodiesterase-5 immunoreactivity was localized in the intercalated discs between the myocardial cells. The staining intensity was reduced by L-NAME, and sildenafil treatment abolished this reduction. Consistent with these results, the plasma levels of cGMP were decreased in the L-NAME-treated rats but not in rats that were treated with L-NAME + sildenafil. CONCLUSION: The sildenafil-induced attenuation of the deleterious hemodynamic and cardiac morphological effects of L-NAME in cardiac myocytes is mediated (at least in part) by the inhibition of phosphodiesterase-5.
Resumo:
Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.
Resumo:
As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.
Resumo:
Introduction. This protocol aims at ( a) evaluating the resistance to post-harvest diseases within different genotypes of bananas, and ( b) comparing different origins of bananas ( geographic origin, physiological stage, etc.) for their susceptibility to post-harvest diseases. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. Materials required and details of the twelve steps of the protocol ( fruit sampling and inoculum preparation, wound anthracnose resistance study, quiescent anthracnose resistance study and crown-rot resistance study) are described. Results. Typical symptoms of the different diseases are obtained after artificial inoculation.