807 resultados para Discrete events
Resumo:
This paper studies the limits of discrete time repeated games with public monitoring. We solve and characterize the Abreu, Milgrom and Pearce (1991) problem. We found that for the "bad" ("good") news model the lower (higher) magnitude events suggest cooperation, i.e., zero punishment probability, while the highrt (lower) magnitude events suggest defection, i.e., punishment with probability one. Public correlation is used to connect these two sets of signals and to make the enforceability to bind. The dynamic and limit behavior of the punishment probabilities for variations in ... (the discount rate) and ... (the time interval) are characterized, as well as the limit payo¤s for all these scenarios (We also introduce uncertainty in the time domain). The obtained ... limits are to the best of my knowledge, new. The obtained ... limits coincide with Fudenberg and Levine (2007) and Fudenberg and Olszewski (2011), with the exception that we clearly state the precise informational conditions that cause the limit to converge from above, to converge from below or to degenerate. JEL: C73, D82, D86. KEYWORDS: Repeated Games, Frequent Monitoring, Random Pub- lic Monitoring, Moral Hazard, Stochastic Processes.
Resumo:
Rapidly-flowing sectors of an ice sheet (ice streams) can play ail important role in abrupt climate change through tile delivery of icebergs and meltwater and tile Subsequent disruption of ocean thermohaline circulation (e.g., the North Atlantic's Heinrich events). Recently, several cores have been raised from the Arctic Ocean which document the existence of massive ice export events during tile Late Pleistocene and whose provenance has been linked to Source regions in the Canadian Arctic Archipelago. In this paper, satellite imagery is used to map glacial geomorphology in the vicinity of Victoria Island, Banks Island and Prince of Wales Island (Canadian Arctic) in order to reconstruct ice flow patterns in the highly complex glacial landscape. A total of 88 discrete flow-sets are mapped and of these, 13 exhibit the characteristic geomorphology of palaeo-ice streams (i.e., parallel patterns of large, highly elongated mega-scale glacial lineations forming a convergent flow pattern with abrupt lateral margins). Previous studies by other workers and cross-cutting relationships indicate that the majority of these ice streams are relatively young and operated during or immediately prior to deglaciation. Our new mapping, however, documents a large (> 700 km long; 110 km wide) and relatively old ice stream imprint centred in M'Clintock Channel and converging into Viscount Melville Sound. A trough mouth fan located on the continental shelf Suggests that it extended along M'Clure Strait and was grounded at tile shelf edge. The location of the M'Clure Strait Ice Stream exactly matches the Source area of 4 (possibly 5) major ice export events recorded in core PS 1230 raised from Fram Strait, the major ice exit for the Arctic Ocean. These ice export events occur at similar to 12.9, similar to 15.6, similar to 22 and 29.8 ka (C-14 yr BP) and we argue that they record vigorous episodes of activity of the M'Clure Strait Ice Stream. The timing of these events is remarkably similar to the North Atlantic's Heinrich events and we take this as evidence that the M'Clure Strait Ice Stream was also activated around the same time. This may hold important implications for tile cause of the North Atlantic's Heinrich events and hints at tile possibility of a pall-ice sheet response. (c) 2005 Elsevier B.V. All rights reserved.
Resumo:
A rheological model of sea ice is presented that incorporates the orientational distribution of ice thickness in leads embedded in isotropic floe ice. Sea ice internal stress is determined by coulombic, ridging and tensile failure at orientations where corresponding failure criteria are satisfied at minimum stresses. Because sea ice traction increases in thinner leads and cohesion is finite, such failure line angles are determined by the orientational distribution of sea ice thickness relative to the imposed stresses. In contrast to the isotropic case, sea ice thickness anisotropy results in these failure lines becoming dependent on the stress magnitude. Although generally a given failure criteria type can be satisfied at many directions, only two at most are considered. The strain rate is determined by shearing along slip lines accompanied by dilatancy and closing or opening across orientations affected by ridging or tensile failure. The rheology is illustrated by a yield curve determined by combining coulombic and ridging failure for the case of two pairs of isotropically formed leads of different thicknesses rotated with regard to each other, which models two events of coulombic failure followed by dilatancy and refreezing. The yield curve consists of linear segments describing coulombic and ridging yield as failure switches from one lead to another as the stress grows. Because sliding along slip lines is accompanied by dilatancy, at typical Arctic sea ice deformation rates a one-day-long deformation event produces enough open water that these freshly formed slip lines are preferential places of ridging failure.
Resumo:
Ionospheric plasma flow measurements and simultaneous observations of thin (∼0.2° invariant latitude (ILAT)), multiple, longitudinally extended auroral arcs of transient nature within 74°-76° ILAT and 1030-1130 UT (∼14-15 MLT) on January 12, 1989, are reported. The auroral structures appeared within the luminous belt of strong 630.0-nm emissions located predominantly on sunward convecting field lines equatorward of the convection reversal boundary as identified by the European Incoherent Scatter UHF radar. The events occurred during a period of several hours quasi-steady solar wind speed (∼ 700 km s−1) and a radially orientated interplanetary magnetic field (IMF) with a weak northward tilt (IMF Bz>0). These typical dayside auroral features are related to previous studies of auroral activity related to the upward region 1 current in the postnoon sector. The discrete auroral events presented here may result from magnetosheath plasma injections into the low-latitude boundary layer (LLBL) and an associated dynamo mechanism. An alternative explanation invokes kinetic Alfvén waves, triggered either by Kelvin-Helmholtz instability at the inner (or outer) edge of the LLBL or by pressure pulse induced magnetopause surface waves.
Resumo:
Combined optical and radar observations of two breakup-like auroral events near the polar cap boundary, within 74–76° MLAT and 1210 – 1240 UT (roughly 1540 – 1610 MLT) on 9 Jan. 1989 are reported. A two-component structure of the auroral phenomenon is indicated, with a local intensification of the pre-existing arc as well as a separate, tailward moving discrete auroral event on the poleward side of the background aurora, close to the reversal between well-defined zones of sunward and tailward ion flows. The all-sky TV observations do not indicate a connection between the two components, which also show different optical spectral composition. The 16 MLT background arc is located on sunward convecting field lines, as opposed to the 12–14 MLT auroral emission observed on this day. Although the magnetospheric plasma source (s) of the 16 MLT events are not easily identified from these ground-based data alone, it is suggested that the lower and higher latitude components, may map to the plasma sheet boundary layer and along open field lines to the magnetopause boundary, respectively. The events occur at the time of enhancements of westward ionospheric ion flow and corresponding eastward electrojet current south of 74° MLAT. Thus, they seem to be very significant events, involving periodic (10 min period), tailward moving filaments of field-aligned current/discrete auroral emission at the 16 MLT polar cap boundary.
Resumo:
Combined observations by meridian-scanning photometers, all-sky auroral TV camera and the EISCAT radar permitted a detailed analysis of the temporal and spatial development of the midday auroral breakup phenomenon and the related ionospheric ion flow pattern within the 71°–75° invariant latitude radar field of view. The radar data revealed dominating northward and westward ion drifts, of magnitudes close to the corresponding velocities of the discrete, transient auroral forms, during the two different events reported here, characterized by IMF |BY/BZ| < 1 and > 2, respectively (IMF BZ between −8 and −3 nT and BY > 0). The spatial scales of the discrete optical events were ∼50 km in latitude by ∼500 km in longitude, and their lifetimes were less than 10 min. Electric potential enhancements with peak values in the 30–50 kV range are inferred along the discrete arc in the IMF |BY/BZ| < 1 case from the optical data and across the latitudinal extent of the radar field of view in the |BY/BZ| > 2 case. Joule heat dissipation rates in the maximum phase of the discrete structures of ∼ 100 ergs cm−2 s−1 (0.1 W m−2) are estimated from the photometer intensities and the ion drift data. These observations combined with the additional characteristics of the events, documented here and in several recent studies (i.e., their quasi-periodic nature, their motion pattern relative to the persistent cusp or cleft auroral arc, the strong relationship with the interplanetary magnetic field and the associated ion drift/E field events and ground magnetic signatures), are considered to be strong evidence in favour of a transient, intermittent reconnection process at the dayside magnetopause and associated energy and momentum transfer to the ionosphere in the polar cusp and cleft regions. The filamentary spatial structure and the spectral characteristics of the optical signature indicate associated localized ˜1-kV potential drops between the magnetopause and the ionosphere during the most intense auroral events. The duration of the events compares well with the predicted characteristic times of momentum transfer to the ionosphere associated with the flux transfer event-related current tubes. It is suggested that, after this 2–10 min interval, the sheath particles can no longer reach the ionosphere down the open flux tube, due to the subsequent super-Alfvénic flow along the magnetopause, conductivities are lower and much less momentum is extracted from the solar wind by the ionosphere. The recurrence time (3–15 min) and the local time distribution (∼0900–1500 MLT) of the dayside auroral breakup events, combined with the above information, indicate the important roles of transient magnetopause reconnection and the polar cusp and cleft regions in the transfer of momentum and energy between the solar wind and the magnetosphere.
Resumo:
Background: Concerted evolution is normally used to describe parallel changes at different sites in a genome, but it is also observed in languages where a specific phoneme changes to the same other phoneme in many words in the lexicon—a phenomenon known as regular sound change. We develop a general statistical model that can detect concerted changes in aligned sequence data and apply it to study regular sound changes in the Turkic language family. Results: Linguistic evolution, unlike the genetic substitutional process, is dominated by events of concerted evolutionary change. Our model identified more than 70 historical events of regular sound change that occurred throughout the evolution of the Turkic language family, while simultaneously inferring a dated phylogenetic tree. Including regular sound changes yielded an approximately 4-fold improvement in the characterization of linguistic change over a simpler model of sporadic change, improved phylogenetic inference, and returned more reliable and plausible dates for events on the phylogenies. The historical timings of the concerted changes closely follow a Poisson process model, and the sound transition networks derived from our model mirror linguistic expectations. Conclusions: We demonstrate that a model with no prior knowledge of complex concerted or regular changes can nevertheless infer the historical timings and genealogical placements of events of concerted change from the signals left in contemporary data. Our model can be applied wherever discrete elements—such as genes, words, cultural trends, technologies, or morphological traits—can change in parallel within an organism or other evolving group.
Resumo:
The linear quadratic Gaussian control of discrete-time Markov jump linear systems is addressed in this paper, first for state feedback, and also for dynamic output feedback using state estimation. in the model studied, the problem horizon is defined by a stopping time τ which represents either, the occurrence of a fix number N of failures or repairs (T N), or the occurrence of a crucial failure event (τ δ), after which the system paralyzed. From the constructive method used here a separation principle holds, and the solutions are given in terms of a Kalman filter and a state feedback sequence of controls. The control gains are obtained by recursions from a set of algebraic Riccati equations for the former case or by a coupled set of algebraic Riccati equation for the latter case. Copyright © 2005 IFAC.
Resumo:
A question often posed in protein folding/unfolding studies is whether the process is fully cooperative or whether it contains sequential elements. To address this question, one needs tools capable of resolving different events. It seems that, at least in certain cases, two-dimensional (2D) IR correlation spectroscopy can provide answers to this question. To illustrate this point, we have turned to the Cro-V55C dimer of the λ Cro repressor, a protein known to undergo thermal unfolding in two discrete steps through a stable equilibrium intermediate. The secondary structure of this intermediate is compatible with that of a partially unfolded protein and involves a reorganization of the N terminus, whereas the antiparallel β-ribbon formed by the C-terminal part of each subunit remains largely intact. To establish whether the unfolding process involves sequential events, we have performed a 2D correlation analysis of IR spectra recorded over the temperature range of 20–95°C. The 2D IR correlation analysis indeed provides evidence for a sequential formation of the stable intermediate, which is created in three (closely related) steps. A first step entails the unfolding of the short N-terminal β-strand, followed by the unfolding of the α-helices in a second step, and the third step comprises the reorganization of the remaining β-sheet and of some unordered segments in the protein. The complete unfolding of the stable intermediate at higher temperatures also undergoes sequential events that ultimately end with the breaking of the H bonds between the two β-strands at the dimer interface.
Resumo:
This paper presents a discrete formalism for temporal reasoning about actions and change, which enjoys an explicit representation of time and action/event occurrences. The formalism allows the expression of truth values for given fluents over various times including nondecomposable points/moments and decomposable intervals. Two major problems which beset most existing interval-based theories of action and change, i.e., the so-called dividing instant problem and the intermingling problem, are absent from this new formalism. The dividing instant problem is overcome by excluding the concepts of ending points of intervals, and the intermingling problem is bypassed by means of characterising the fundamental time structure as a well-ordered discrete set of non-decomposable times (points and moments), from which decomposable intervals are constructed. A comprehensive characterisation about the relationship between the negation of fluents and the negation of involved sentences is formally provided. The formalism provides a flexible expression of temporal relationships between effects and their causal events, including delayed effects of events which remains a problematic question in most existing theories about action and change.
Resumo:
The dynamics of intracellular Ca²⁺ is driven by random events called Ca²⁺ puffs, in which Ca²⁺ is liberated from intracellular stores. We show that the emergence of Ca²⁺ puffs can be mapped to an escape process. The mean first passage times that correspond to the stochastic fraction of puff periods are computed from a novel master equation and two Fokker-Planck equations. Our results demonstrate that the mathematical modeling of Ca²⁺ puffs has to account for the discrete character of the Ca²⁺ release sites and does not permit a continuous description of the number of open channels.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.
Resumo:
Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.