901 resultados para Bacterial Fruit Blotch


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to quantify radiographically the periapical bone resorption in dogs' teeth contaminated with bacterial endotoxin (LPS), associated or not with calcium hydroxide. After pulp tissue removal, 60 premolars were randomly assigned to 4 groups and were either filled with LPS (group 1), filled with LPS plus calcium hydroxide (group 2) or filled with saline (group 3) for a period of 30 days. In group 4, periapical lesion formation was induced with no canal treatment. Standardized radiographs were taken at the beginning of the treatment and after 30 days and the Image J Program was used for measurement of periapical lesion size. Periapical lesions were observed in groups 1 (average of 8.44 mm2) and 4 (average of 3.02 mm2). The lamina dura was intact and there were no areas of periapical bone resorption in groups 2 and 3. It may be concluded that calcium hydroxide was effective in inactivating LPS, as demonstrated by the absence of apical periodontitis in the roots that were filled with bacterial endotoxin plus calcium hydroxide.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study evaluated the antifungal action of biomolecules produced from the secondary metabolism of bacterial strains found in the rhizosphere of semi arid plants against human pathogenic Candida albicans. Crude extracts were obtained using ethyl acetate as an organic solvent and the bioactivity was assessed with a bioautography technique. The results showed that bacterial strains, Alcaligenes faecalis MRbS12 and Bacillus cereus MRbS26, had compounds with antifungal bioactivity. The largest inhibition zones for both compounds were located on spots with Rf values below 0.500, indicating that the molecules possibly had polar characteristics. These results suggested that microorganisms found in the environment could have bioprospecting potential.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction. This protocol aims at ( a) evaluating the resistance to post-harvest diseases within different genotypes of bananas, and ( b) comparing different origins of bananas ( geographic origin, physiological stage, etc.) for their susceptibility to post-harvest diseases. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. Materials required and details of the twelve steps of the protocol ( fruit sampling and inoculum preparation, wound anthracnose resistance study, quiescent anthracnose resistance study and crown-rot resistance study) are described. Results. Typical symptoms of the different diseases are obtained after artificial inoculation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction. We present some protocols aiming at partially characterizing banana fruit quality through measurement of some key biochemical parameters. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. This part describes the required laboratory materials and the steps necessary for achieving four protocols making it possible to measure sugar, organic acids and free ACC contents, and in vitro ACC oxidase activity. Results. Standard results obtained by using the protocols described are presented in the figures.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tamarindus indica has been used in folk medicine as an antidiabetic, a digestive aid, and a carminative, among other uses. Currently, there is no information in the toxicology literature concerning the safety of T. indica extract. We evaluated the clastogenic and/or genotoxic potential of fruit pulp extract of this plant in vivo in peripheral blood and liver cells of Wistar rats, using the comet assay, and in bone marrow cells of Swiss mice, using the micronucleus test. The extract was administered by gavage at doses of 1000, 1500 and 2000 mg/kg body weight. Peripheral blood and liver cells from Wistar rats were collected 24 h after treatment, for the comet assay. The micronucleus test was carried out in bone marrow cells from Swiss mice collected 24 h after treatment. The extract made with T. indica was devoid of clastogenic and genotoxic activities in the cells of the rodents, when administered orally at these three acute doses.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The citrus greening (or huanglongbing) disease has caused serious problems in citrus crops around the world. An early diagnostic method to detect this malady is needed due to the rapid dissemination of Candidatus Liberibacter asiaticus (CLas) in the field. This analytical study investigated the fluorescence responses of leaves from healthy citrus plants and those inoculated with CLas by images from a stereomicroscope and also evaluated their potential for the early diagnosis of the infection caused by this bacterium. The plants were measured monthly, and the evolution of the bacteria on inoculated plants was monitored by real-time quantitative polymerase chain reaction (RT-qPCR) amplification of CLas sequences. A statistical method was used to analyse the data. The selection of variables from histograms of colours (colourgrams) of the images was optimized using a paired Student's t-test. The intensity of counts for green colours from images of fluorescence had clearly minor variations for healthy plants than diseased ones. The darker green colours were the indicators of healthy plants and the light colours for the diseased. The method of fluorescence images is novel for fingerprinting healthy and diseased plants and provides an alternative to the current method represented by PCR and visual inspection. A new, non-subjective pattern of analysis and a non-destructive method has been introduced that can minimize the time and costs of analyses.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction: Treatment of severe bacterial peritonitis, especially by videolaparoscopy, is still a matter of investigation. The aim of the present study was to evaluate the effect of videolaparoscopy and laparotomy access with or without antibiotics on the outcome of severe bacterial peritonitis in rats. Materials and Methods: Sixty-four male Wistar rats were equally assigned to 8 groups: Sham surgery (SHAM), SHAM+antibiotics (SHAM+AB), cecal ligation and puncture (CLP), CLP+AB, CLP+videolaparoscopy (VLAP), CLP+laparotomy (LAP), VLAP+AB, and LAP+AB. All treated animals were submitted to an evaluation of bacteremia, white cell counts, and cytokine determinations: interleukin (IL)-1, IL-6, and tumor necrosis factor-alpha (TNF-alpha). The groups treated with antibiotics received gentamicin and metronidazole. Survival was monitored over a period of 7 days. Results: Peritonitis induced by CLP was severe, with IL-1, IL-6, and TNF-alpha levels and lethality being significantly higher compared to the SHAM group. The IL-6 levels in the VLAP group were significantly higher compared to the CLP and VLAP+AB groups, and the TNF-alpha levels in the VLAP and LAP+AB groups were significantly higher compared to the LAP group. The survival time was significantly higher in the CLP+AB and VLAP+AB groups, when compared to the CLP group. There was no significant difference in bacteremia and lethality rates between the resources employed for treatment of peritonitis. Conclusions: Although the use of laparoscopic access itself exacerbates the inflammatory response, the combination with antibiotics minimizes this effect and increases the survival time. However, all of the resources used for treating severe peritonitis, when applied alone or in combination, have an equivalent influence on bacteremia and lethality rates.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Real-time (RT)-PCR increases diagnostic yield for bacterial meningitis and is ideal for incorporation into routine surveillance in a developing country. We validated a multiplex RT-PCR assay for Streptococcus pneumoniae, Neisseria meningitidis, and Haemophilus influenzae in Brazil. Risk factors for being culture-negative, RT-PCR positive were determined. The sensitivity of RT-PCR in cerebrospinal fluid (CSF) was 100% (95% confidence limits, 96.0%-100%) for N. meningitidis, 97.8% (85.5%-99.9%) for S. pneumoniae, and 66.7% (9.4%-99.2%) for H. influenzae. Specificity ranged from 98.9% to 100%. Addition of RT-PCR to routine microbiologic methods increased the yield for detection of S. pneumoniae, N. meningitidis, and H. influenzae cases by 52%, 85%, and 20%, respectively. The main risk factor for being culture negative and RT-PCR positive was presence of antibiotic in CSF (odds ratio 12.2, 95% CI 5.9-25.0). RT-PCR using CSF was highly sensitive and specific and substantially added to measures of meningitis disease burden when incorporated into routine public health surveillance in Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mutualistic networks are crucial to the maintenance of ecosystem services. Unfortunately, what we know about seed dispersal networks is based only on bird-fruit interactions. Therefore, we aimed at filling part of this gap by investigating bat-fruit networks. It is known from population studies that: (i) some bat species depend more on fruits than others, and (ii) that some specialized frugivorous bats prefer particular plant genera. We tested whether those preferences affected the structure and robustness of the whole network and the functional roles of species. Nine bat-fruit datasets from the literature were analyzed and all networks showed lower complementary specialization (H(2)' = 0.3760.10, mean 6 SD) and similar nestedness (NODF = 0.5660.12) than pollination networks. All networks were modular (M=0.32 +/- 0.07), and had on average four cohesive subgroups (modules) of tightly connected bats and plants. The composition of those modules followed the genus-genus associations observed at population level (Artibeus-Ficus, Carollia-Piper, and Sturnira-Solanum), although a few of those plant genera were dispersed also by other bats. Bat-fruit networks showed high robustness to simulated cumulative removals of both bats (R = 0.55 +/- 0.10) and plants (R = 0.68 +/- 0.09). Primary frugivores interacted with a larger proportion of the plants available and also occupied more central positions; furthermore, their extinction caused larger changes in network structure. We conclude that bat-fruit networks are highly cohesive and robust mutualistic systems, in which redundancy is high within modules, although modules are complementary to each other. Dietary specialization seems to be an important structuring factor that affects the topology, the guild structure and functional roles in bat-fruit networks.