The expression of TLR9 in human cutaneous leishmaniasis is associated with granuloma

P>The Toll-like receptor (TLR) signalling pathway is the first system that defends against Leishmania. After recognising Leishmania as nonself, TLRs trigger NF-kappa B expression. NF-kappa B proceeds to the nucleus and promotes the transcription of pro-inflammatory cytokines. TLR9 is thus an important factor in the induction of an effective immune response against Leishmania. We examined the pattern of TLR9 expression in 12 patients with cutaneous leishmaniasis caused by Leishmania braziliensis detected by polymerase chain reaction. Normal skin was analysed as a negative control. TLR9 expression was examined in the dermis and epidermis by immunohistochemical analysis of paraffin-embedded biopsy tissue. TLR9 expression was primarily observed in the granuloma. The protein was detected in a few cells in the dermis. A lower expression level was detected in the epidermis of patients with leishmaniasis when compared with normal skin. The presence of TLR9 in the skin of patients with cutaneous leishmaniasis is associated with granuloma and expressed by macrophages.

Interstitial expression of angiotensin II and AT1 receptor are increased in patients with progressive glomerulopathies

In animal models, interstitial angiotensin II (ang II) and AT1 receptor (AT1R) are key mediators of renal inflammation and fibrosis in progressive chronic nephropathies. We hypothesized that these molecules were overexpressed in patients with progressive glomerulopathies. In this observational retrospective study, we described the expression of ang II and AT1R by immunohistochemistry in kidney biopsies of 7 patients with minimal change disease (MCD) and in 25 patients with progressive glomerulopathies (PGPs). Proteinuria, serum albumin, and serum creatinine were not statistically different between MCD and PGP patients. Total expression of ang II and AT1R was not statistically different between MCD (108.7 +/- 11.5 and 73.2 +/- 13.6 cells/mm(2), respectively) and PGN patients (100.7 +/- 9.0 and 157.7 +/- 13.8 cells/mm(2), respectively; p>0.05). Yet, interstitial expression of ang II and AT1R (91.6 +/- 16.0 and 45.6 +/- 5.4 cells/mm(2), respectively) was higher in patients with PGN than in those with MCD (22.0 +/- 4.1 and 17.9 +/- 2.9 cells/mm(2), respectively, p<0.05), as was the proportion of interstitial fibrosis (11.0 +/- 0.7% versus 6.1 +/- 1.2%, p<005). In patients with MCD, ang II and AT1R expressions predominate in the tubular compartment (52% and 36% of the positive cells, respectively). In those with PGP, the interstitial expression of ang II and AT1R predominates (58% and 45%, respectively). In conclusion, interstitial expression of ang II and AT1R is increased in patients with progressive glomerulopathies. The relationship of these results and interstitial fibrosis and disease progression in humans warrants further investigations.

ERCC1 protein, mRNA expression and T19007C polymorphism as prognostic markers in head and neck squamous cell carcinoma patients treated with surgery and adjuvant cisplatin-based chemoradiation

Adjuvant cisplatin-based chemoradiation improves survival in HNSCC patients presenting with risk features. ERCC1 (excision repair cross-complementation group 1) is associated with resistance to chemo- and radiation therapy and may have a prognostic value in HNSCC patients. Here we studied ERCC1 expression and the polymorphism T19007C as prognostic markers in these patients. This is a retrospective and translational analysis, where ERCC1 protein expression was evaluated by immunohistochemistry, using an H-score, and mRNA expression was determined by RT-PCR. T 19007C genotypes were detected by PCR-RFLP carried out using DNA template extracted from normal lymph nodes. A high H-score was seen in 32 patients (54%), who presented better 5-year overall survival (5-y OS: 50% vs. 18%, HR 0.43, p=0.026). Fifteen out of 45 patients (33%), with high mRNA expression, presented better 5-year overall survival (OS) (86% vs. 30%, HR 0.26, p=0.052). No OS difference was detected among T 19007C genotypes. High H-score and mRNA expression remained significant as favorable prognostic factors in a multivariate analysis. Collectively, our results suggest that high ERCC1 expression seems to be associated with better OS rates in HNSCC patients submitted to adjuvant cisplatin-based chemoradiation.

Regulation of CSF-1 receptor expression

Cells of the mononuclear phagocyte lineage possess receptors for macrophage colony-stimulating factor (CSF-1) encoded by the c-fms protooncogene and respond to CSF-1 with increased survival, growth, differentiation, and reversible changes in function. The c-fms gene is itself a macrophage differentiation marker. In whole mount analyses of mRNA expression in embryos, c-fms is expressed at very high levels on placental trophoblasts. It is detectable on individual cells in the yolk sac around 8.5 to 9 days postcoitus, appears on isolated cells in the head of the embryo around 9.5 dpc, and appears on numerous cells throughout the embryo by day 10.5. The extent of c-fms expression is much greater than for other macrophage-specific genes including lysozyme and a macrophage-specific protein tyrosine phosphatase. Our studies of the cis-acting elements of the c-fms promoter have indicated a key role for collaboration between the macrophage-specific transcription factor, Pu.1, which functions in determining the site of transcription initiation, and other members of the Ets transcription factor family. This is emerging as a common pattern in macrophage-specific promoters. We have shown that two PU box elements alone can function as a macrophage-specific promoter. The activity of both the artifical promoter and the c-fms promoter is activated synergistically by coexpression of Pu.1 and another Ets factor, c-Ets-2. A 3.5kb c-fms exon 2 promoter (but not the 300bp proximal promoter) is also active in a wide diversity of tumor cell lines. The interesting exception is the melanoma cell line K1735, in which the promoter is completely shut down and expression of c-fms causes growth arrest and cell death. The activity of the exon 2 promoter in these nonmacrophages is at least as serum responsive as the classic serum-responsive promoter of the c-fos gene. It is further inducible in nonmacrophages by coexpression of the c-fms product. Unlike other CSF-1/c-fms-responsive promoters, the c-fms promoter is not responsive to activated Ras even when c-Ets-2 is coexpressed. In most lines, production of full length c-fms is prevented by a downstream intronic terminator, but in Lewis lung carcinoma, read-through does occur, and expression of both c-fms and other macrophage-specific genes such as lysozyme and urokinase becomes detectable in conditions of serum deprivation. (C) 1997 Wiley-Liss, Inc.

In situ hybridization detection of homeobox genes reveals distinct expression patterns in oral squamous cell carcinomas

Aims: To analyse the expression of three homeobox genes (HOXA7, PITX1 and PRRX1) in oral squanous cell carcinomas (OSCC) and the relationship of such expression to certain distinct histopathological features of OSCC and in comparison to adjacent non-neoplastic epithelium (NT). Methods and results: Digoxigenin-labelled riboprobes that are specific for each homeobox gene were generated and in situ hybridization was carried out on frozen sections. In NT samples, HOXA7 and PITX1 transcripts were found more frequently in all epithelial layers, while PRRX1 was expressed in the basal layer. With OSCC samples, expression of the three genes was associated with all histological features. However, the HOXA7 and PITX1 signals were more intense in sheets and nests and PRRX1 in small nests and isolated cells. Conclusion: HOXA7, PIXT1 and PRRX1 homeobox genes have different patterns of expression in OSCC depending on its histological features.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Expression Profile of p63 in 127 Patients with Laryngeal Squamous Cell Carcinoma

Objectives: To evaluate p63 expression in laryngeal squamous cell carcinoma and its prognostic significance. Methods: p63 expression was examined by immunohistochemistry and scored in 127 patients with laryngeal squamous cell carcinomas. Results: Sixty-two cases had scored 3, sixty had scored 2, four had scored 1 and one case did not show any expression (48.8, 47.2, 3.1 and 0.8%, respectively). Overall survival was 73.9% at 24 months and 59.5% at 60 months. The disease-free survival was 77.2 and 75.1%, and the disease-specific survival was 79 and 67% at 24 and 60 months, respectively. Uni- and multivariate analysis identified that decreased immunoexpression of protein p63 was a statistically significant factor for the risk of recurrence and death by cancer. Conclusions: p63 expression was highly prevalent in laryngeal squamous cell carcinomas, and its underexpression was correlated with a worse prognosis. Copyright (C) 2010 S. Karger AG, Basel

EXPRESSION OF MEMBRANE TYPE 1 MATRIX METALLOPROTEINASE IN MEDULLARY THYROID CARCINOMA: PROGNOSTIC IMPLICATIONS

Background. Clinical and pathologic examinations cannot always provide a prognosis for patients with medullary thyroid carcinoma. Membrane type 1 matrix metalloproteinase (MT1-MMP) can act directly on carcinogenesis and takes part in 1 of the processes of metalloproteinase 2 activation, an enzyme related to prognostic impairment of patients with such tumor. Methods. Thirty-five patients who were submitted to surgery were followed up for an average of 74 months, Postoperative and final medical conditions were characterized for comparison with MT1-MMP immunostainings, performed in surgical paraffin blocks. A value of p < .05 was considered statistically significant. Results. Proposed index (association of proportion and intensity of immunostaining) and proportion of immunostained cells in primary specimens were correlated with cure or persistence after initial operations (p = .0216 and p = .0098, respectively). Conclusion. MT1-MMP immunostaining in primary tumor specimens is a new and complementary prognostic predictor in patients with medullary thyroid carcinomas. (C) 2009 Wiley Periodicals, Inc. Head Neck 32: 58-67, 2010

Pentoxifylline modifies three-dimensional collagen lattice model contraction and expression of collagen types I and III by human fibroblasts derived from post-burn hypertrophic scars and from normal skin

Fibroblasts are thought to be partially responsible for the persisting contractile forces that result in burn contractures. Using a monolayer cell culture and fibroblast populated collagen lattice (FPCL) three-dimensional model we subjected hypertrophic scar and non-cicatricial fibroblasts to the antifibrogenic agent pentoxifylline (PTF - 1 mg/mL) in order to reduce proliferation, collagen types I and III synthesis and model contraction. Fibroblasts were isolated from post-burn hypertrophic scars (HSHF) and non-scarred skin (NHF). Cells were grown in monolayers or incorporated into FPCL`s and exposed to PTF. In monolayer, cell number proliferation was reduced (46.35% in HSHF group and 37.73% in NHF group, p < 0.0001). PTF selectively inhibited collagen III synthesis in the HSHF group while inhibition was more evident to type I collagen synthesis in the NHF group. PTF also reduced contraction in both (HSHF and NHF) FPCL. (C) 2009 Elsevier Ltd and ISBI. All rights reserved.

Expression of resistance by tetraploid and diploid lucerne genotypes to Phytophthora medicaginis is not influenced by inoculum level or by temperature

Phytophthora-resistant lucerne cultivars do not always perform well under conditions of high disease pressure in the field. To determine whether resistance expression remains stable under different infection intensities, tetraploid and diploid lucerne genotypes, genotypically defined for their reactions to Phytophthora medicaginis, were clonally propagated, and the influence of different reproducible inoculum levels (0 . 5 and 5 . 0 g dry weight mycelium/kg dry weight potting mix), the period of exposure to these levels (10-60 days), and temperature (16/22 degrees C and 24/30 degrees C) on disease expression was determined in controlled environments. Generally, expression of resistance by resistant genotypes, remained stable under these conditions. Biotic (e.g. Aphanomyces eutiches) or abiotic factors other than P. medicaginis may be responsible for the poorer than expected performance under field conditions in some instances, or the percentage of resistant plants in some cultivars currently classified as resistant is insufficient to provide buffering against productivity reductions under severe epidemics. Further research is needed to clarify the situation.

Thalidomide treatment down-regulates SDF-1 alpha and CXCR4 expression in multiple myeloma patients

The chemokine stromal-derived factor-1 alpha (SDF-1 alpha) and its receptor CXCR4 are critically involved in directional migration and homing of plasma cells in multiple myeloma. Here, we show that the expression of SDF-1 alpha and CXCR4 was significantly down-regulated in patients treated with thalidomide (n = 10) as compared to newly diagnosed MM patients (n = 31) and MM patients treated with other drugs (n = 38). SDF-1 alpha and CXCR4 expression was also significantly decreased in a RPMI 8226 cell line treated with 10 and 20 mu mol/L of thalidomide. Our findings indicate that thalidomide therapy induces down-regulation of CXCR4 and its ligand SDF-1 alpha in multiple myeloma. (c) 2008 Elsevier Ltd. All rights reserved.

Altered adhesion molecules expression on peripheral blood mononuclear cells from patients with systemic sclerosis and clinical correlations

The aim of the study was to evaluate the expressions of adhesion molecules (AM) on peripheral blood mononuclear cells (PBMNC) from systemic sclerosis (SSc) patients. Thirty-one SSc patients (ACR) and 20 normal subjects were selected for the study. PBMNC were analyzed for LFA-1 alpha, LFA-1 beta, ICAM-3, ICAM-1, and l-selectin expressions. ICAM-3 expression was decreased while ICAM-1 was increased on SSc PBMNC, compared to controls (p = 0.04 and 0.003, respectively). A positive association was found between LFA-1 alpha (r = 0.37, p = 0.03), LFA-1 beta (r = 0.38, p = 0.002), ICAM-3 (r = 0.42, p = 0.01), and l-selectin (r = 0.38, p = 0.03) expressions and greater number of immunosuppressive drugs taken by SSc patients. Also, anti-centromeric positive SSc patients had lower expressions of LFA-1 alpha, LFA-1 beta, ICAM-3, and l-selectin. Lower expression of ICAM-3 and higher expression of ICAM-1 suggest that AMs may be involved in the pathogenesis of scleroderma.

p63 Protein expression in high risk diffuse large B-cell lymphoma

Background: p63 gene is a p53 homologue that encodes proteins with transactivation, DNA-binding and tetramerisation domains. The isoforms TAp63 and TAp73 transactivate p53 target genes and induce apoptosis, whereas the isoforms Delta Np63 and Delta Np73 lack transactivation and might have dominant-negative effects in p53 family members. p63 is expressed in germinal centre lymphocytes and can be related to the development of the lymphoma, but the prognostic significance of its expression in the survival of patients with diffuse large B-cell lymphoma (DLBCL) remains unclear. Aims: To determine whether quantitative immunohistochemical (IHC) analysis of p63 protein expression correlates with CD10 antigen, Bcl-6 antigen and IRF4 antigen expression and to determine whether p63 is a surrogate predictor of overall survival in high-intermediate and high risk DLBCL populations. Methods: CD10, Bcl-6 and IRF4 expression were retrospectively evaluated by IHC in 73 samples of high intermediate and high risk DLBCL and were used to divide the lymphomas into subgroups of germinal centre B-celllike (GCB) and activate B-cell-like (ABC) DLBCL. Similarly, p63 expression was evaluated by IHC and the results were compared with subgroups of DLBCL origin and with the survival rates for these patients. Results: p63 was expressed in more than 50% of malignant cells in 11 patients and did not show correlation with subgroups of GCB-like DLBCL or ABC-like DLBCL, but p63(+) patients had better disease-free survival (DFS) than those who were negative (p = 0.01). Conclusions: p63(+) high-intermediate and high risk DLBCL patients have a better DFS than negative cases.

Direct evidence for the expression of multiple endogenous retroviruses in the synovial compartment in rheumatoid arthritis

Objective. Circumstantial evidence links retroviruses (RVs) with human autoimmune diseases, The aim of the present study was to obtain direct evidence of RV gene expression in rheumatoid arthritis (RA). Methods. Synovial samples were obtained from patients with RA, patients with osteoarthritis (OA), and normal control subjects, Reverse transcription-polymerase chain reaction (RT-PCR) was performed using synovial RNA and primers to conserved sequences in the polymerase (pol) genes of known RVs. Results. PCR products (n = 857) were cloned and sequenced, Multiple pol transcripts, many with open reading frames, were expressed in every sample, Sequences were aligned and classified into 6 families (F1-F6) that contained 33 groups of known and unknown endogenous RVs (ERVs), each distinguished by a specific, deduced peptide motif, The frequency of sequences in each family was similar between RA, OA, and normal synovial tissue, but differed significantly in RA synovial fluid cells, F1 sequences (undefined, but related to murine and primate type C RVs) were lower in frequency, F2 (ERV-9-related), F4 (HERV-K-related), and F6 (HERV-L-related) sequences were higher in frequency, and F3 (RTVL-H-related) sequences were not detected, in the RA synovial fluid cells compared with the RA synovial tissues. Conclusion. Multiple ERVs are expressed in normal and diseased synovial compartments, but specific transcripts can be differentially expressed in RA.

HUMAN CHOLESTERYL ESTER TRANSFER PROTEIN EXPRESSION ENHANCES THE MOUSE SURVIVAL RATE IN AN EXPERIMENTAL SYSTEMIC INFLAMMATION MODEL: A NOVEL ROLE FOR CETP

Mice expressing human cholesteryl ester transfer protein (huCETP) are more resistant to Escherichia coli bacterial wall LIPS because death rates 5 days after intraperitoneal inoculation of LIPS were higher in wild-type than in huCETP(+/-) mice, whereas all huCETP(+/+) mice remained alive. After LIPS inoculation, plasma concentrations of TNF-alpha and IL-6 increased less in huCETP(+/+) than in wild-type mice. LPS in vitro elicited lower TNF-alpha production by CETP expressing than by wild-type macrophages. In addition, TNF-alpha production by RAW 264.7 murine macrophages increased on incubation with LPS but decreased in a dose-dependent manner when human CETP was added to the medium. Human CETP in vitro enhanced the LIPS binding to plasma high-density lipoprotein/low-density lipoprotein. The liver uptake of intravenous infused C-14-LPS from Salmonella typhimurium was greater in huCETP(+/+) than in wild-type mice. Present data indicate for the first time that CETP is an endogenous component involved in the first line of defense against an exacerbated production of proinflammatory mediators.