Diagnóstico das infecções relacionadas a cateter em recém-nascidos e epidemiologia molecular dos Staphylococcus spp. isolados

Pós-graduação em Biologia Geral e Aplicada - IBB

Isolamento viral e diagnóstico molecular de herpevírus canino

Pós-graduação em Medicina Veterinária - FMVZ

Padronização do Elisa indireto e Western Blot para diagnóstico da artrite-encefalite caprina

Caprine arthritis-encephalitis (CAE) is routinely diagnosed with the Agarose Gel Immunodiffusion (AGID) technique, which is considered to have low sensitivity. The objective of this study was to standardize testing i-Elisa and Western Blot for early detection of antibodies against CAEV in goats and compare the results obtained in these tests with proof of AGID. For standardization of i-Elisa and WB, different concentrations and dilutions of antigen, sera and conjugate were used. In the i-Elisa, rigid microplate with 96 wells was adopted, and the combination that showed the best result was a concentration of 0.5µg/ well of antigen and dilutions of the serum of 1:100 and conjugate of 1:1500. In the WB nitrocellulose membranes were used, and the dilutions of the serum were defined at 1:50 and conjugate at 1:15000. To evaluate the performance of the techniques, 222 goat serum samples were tested and the data were compared with the AGID. The sensitivity and specificity of Elisa-i/IDGA, WB/AGID and WB/Elisa-i were 70% and 91%, 100% and 72.6%, 84.6% and 76.5%, concomitantly. The Kappa index of these tests was 0.35, 0.2 and 0.36, respectively. The i-Elisa and WB techniques were more sensitive than the AGID and can be used as tools for early diagnosis of CAE.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Ultrassonografia transcraniana em cães hígidos: padronização da técnica e descrição anatômica

The study of the nervous system is increasing in Veterinary Medicine. Transcranial ultrasonography (TCUS) has the advantage of being a non-invasive and low cost method compared to computerized tomography (CT) and Magnetic Resonance Imaging (MRI). The temporal bone has been used as an acoustic window in TCUS in humans. This study aimed to correlate transcranial ultrasonographic images obtained through the temporal and occipital window with healthy dog's encephalic anatomy, and to standardize the technique. 37 adult mongrel dogs were used: 30 animals in vivo, in order to perform USTC screening and seven dog corpses for brain section as well as USTC planes. Data analysis was accomplished by the non parametric Wilcoxon test. Results obtained indicate that TCUS (in dorsal and oblique planes) is a viable method for brain evaluation in dogs weighting up to 10kg without anesthesia.

Diferentes técnicas de diagnóstico empregadas na estimativa de prevalência populacional de infecção por Cryptosporidium felis em gatos domiciliados no município de Araçatuba, São Paulo

Pós-graduação em Medicina Veterinária - FCAV

Diagnóstico de resistência anti-helmíntica em bovinos

Pós-graduação em Medicina Veterinária - FMVZ

Entre a expressão e a técnica: a terminologia do professor de canto - um estudo de caso em pedagogia vocal de canto erudito e popular no eixo Rio-São Paulo

Pós-graduação em Música - IA

Diagnóstico morfológico e molecular de Haemonchus spp. em bovinos e ovinos

Pós-graduação em Biologia Geral e Aplicada - IBB

Metástases de carcinoma de mama em cadelas: avaliação da técnica de linfonodo sentinela

Pós-graduação em Medicina Veterinária - FMVZ

Política de indexação na catalogação de assunto em bibliotecas universitárias: a visão sociocognitiva da atuação profissional com protocolo verbal

The indexing policy must be represented by means of a philosophy that reflects the system's aims. One of the aspects concerning the indexing policy is relating to the data retrospective conversion. The general aim is to discuss and make a profound study on indexing policy guidelines and to analyze the elements to set up an indexing policy, that should direct the indexing procedures carried out in university libraries using the methodology of verbal protocol. The results demonstrate that the indexing policy serves as a support for the knowledge organization in the catalog, acting as a guide for the librarian when determining the subjects of the documents described in the records. It is concluded that the indexing only will be carried out in the university library during the documentary information treatment by means of a well determined policy.

Desenvolvimento de biossensor eletroquímico para diagnóstico de dengue

Pós-graduação em Biotecnologia - IQ

Bloqueios anestésicos perineurais da região distal do membro torácico do equino para diagnóstico em claudicações

This work demonstrates the technique of perineural anesthetic blocks made in the distal forelimb of the horse, and also covers aspects relating to the interpretation of the results obtained with the procedure. The limit of the subject the distal forelimb of horses is explained by the distribution of common lameness, being more frequent in this region. The procedure is intended to provide analgesia to a region of the limb, causing the animal to stop limping or decrease the intensity of claudication temporarily, since this region is responsible for the claudication, allowing thus, the likely location of the lesion, which may be investigated by other helper methods to confirm the diagnosis. Besides the description of the technique, were approached concerning aspects to the location of the anatomical structures involved, materials needed, cares with the animals, and possible complications from the procedure

Diagnóstico antropogeomorfológico em bacia hidrográfica urbana: o caso do Córrego do Jardim São João, Araras (SP)

Man can transform the nature according to their needs through technique which enables agriculture, cattle raising, constructions of buildings for housing, transport routes, etc. This action has brought significant transformations to the environment, and relief is one of the most changed elements, mainly at urban areas, which concentrates most of the Brazilian population. In these areas geomorphologic systems have undergone alterations in their flow of matter and energy by the action of man. Thus, it is possible o understand the action of man as geomorphologic action, nowadays, the tecnógeno, since the human action can interfere qualitatively and quantitatively in the input and output of these systems. The anthropic geomorphology has contributed to the analyses of the effects due to the urbanization at the form and at the geomorphologic process in the urban watersheds, indicating the transformations at the shape of the relief and the alterations due to the acceleration of the flow of matter and energy. From these questions, this study had the main diagnose the anthropogenic changes of the relief at the basin of Corrego do Jardim São João, Araras (SP), comparing two scenes, 1997 and 2006, through geomorphological mapping evolutionary in the area. The geomorphological feature altered at the basin are directly linked to the use of soil, mainly at the urban use, which caused effects in the relief at the studied area, making possible to define periods of the urban evolution and impacts caused by the urbanization. Among the changes it was found the decrease of the topographic breaks and at the riverbed channels, as the increase of the accumulation of the plain and riverbed terrace. The elaboration of a letter of the legal restrictions of the basin make possible to evaluate some of the environmental urban problems that occur, which are due to the occupation of the relief in the areas of permanent preservation that brings significant impacts to...

Diferentes métodos de diagnóstico molecular na diferenciação das espécies de Sarcocystis spp

The Sarcocystis genus includes obligatory two-host life cycle protozoan parasites. It is the most numerous of the six genera of the Sarcocystidae family. The infection caused by parasites of this genus is a zoonotic and cosmopolitan disease known as sarcosistosis or sarcosporidiosis. The sarcositosis though frequently asymptomatic in its definitive hosts can be fatal in its intermediate hosts. The usual diagnoses of sarcosistosis takes place through a histological demonstration of schizonts in blood vessels and organs, and the presence of cysts in muscle tissue by necropsy or biopsy, this second method still more common and based on morphological features of the sarcocyst. However, these methods can be inadequate to a precise identification of the infector species once that, besides the genus being of numerous species, these often present similar morphological features. Another factor that makes the diagnostic more difficult is the non specificity of some Sacocystis species to their hosts. Consequently, molecular diagnostic methods have been used in order to identify the infector species and the parasite specific biological cycles, demonstrating also new species and coevolutive aspects between parasite and host. Among the most employed molecular techniques the Polimerase Chain Reaction (PCR), the nested-PCR and the Restriction Fragment Length Polymorphism (RFLP) stands out