993 resultados para sugar-cane bagasse


Relevância:

80.00% 80.00%

Publicador:

Resumo:

Civil society and sugarcane farmer demands indicate that harvesting technology has enough limitations to jeopardize production in large sugar cane producing areas. This work analyses the current mechanical harvesting compared to a semi-mechanical harvesting proposal, on the bases of eleven characteristics considered determinant for a quick spreading of green cane harvesting on hilly areas, with lower impact on agricultural labor and farmers investment capacity.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Currently, owing to the occurrence of environmental problems, along with the need of environmental preservation, both the territory management of Hydrographic Basin and the conservation of natural resources have proven to have remarkable importance. Thus, the mean goal of the research is to raise and scrutinize social-economic and technologic data from the Mogi Guaçu River Hydrographic Basin (São Paulo, Brazil). The aim is to group municipalities with similar characteristics regarding the collected data, which may direct joint actions in the Hydrographic Basin Management. There were used both the methods of factorial analysis and automatic hierarchical classifications. Additionally, there is going to be applied a Geographical Information System to represent the outcomes of the methods aforementioned, through the evolvement of a geo-referenced database, which will allow the obtainment of information categorically distributed including theme maps of interest. The main characteristics adopted to group the municipalities were: agricultural area, sugar cane production, small farms, animal production, number of agriculture machinery and equipments and agricultural income. The methodology adopted in the Mogi Guaçu River Hydrographic Basin will be analyzed vis-à-vis its appropriateness on basin management, as well as the possibility of assisting the studies on behalf of the São Paulo Hydrographic Basin groups, to regional development.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

In this work the performance of a sugar cane chopped harvester was analysed when fed with two sugar cane mass flows, measuring the invisible losses, which are impossible to measure in the field, harvester sugar cane cleaning efficiency and air velocity on extractors exit. The trial was done under controlled conditions at Copersucar Technology Center in January 2000. The results showed that the flow of sugar cane through the harvester doesn't influence the magnitudes of total invisible losses and raw material cleaning efficiency. The mean air velocity on the primary extractors exit was 12.0 m s-1, and 9.2 m s-1 on the secondary extractor, with a coefficient of variation of 21%, indicating that the poor cleaning performance of the harvester could be related to air velocity difference inside the extractor. Analyzing the data collected in the trials, it was possible to conclude that invisible losses in sugar cane harvester were 10% and the cleaning efficiency was 87%.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

One of the problems found in mechanical harvest of sugar cane is the lack of synchronism between the harvest machine and the infield wagon, causing crop losses as well as operational capacity. The objective of the present research was to design a system capable of helping to synchronize the sugar cane harvest machine with the wagon. The communication between tractor and harvest machine is wireless. Two ultrasound sensors coupled to the elevator and a microprocessor manage such information, generating a correct synchronization among the machines. The system was tested in laboratory and on field performing its function adequately, maintaining the two machines in synchronization, indicating and alerting the operators their relative positions. The developed system reduced the sugar cane lost in 60 kg ha-1 comparing to the harvest with the system turned off.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Objetivou-se avaliar os efeitos da ingestão diária de quatro níveis de fósforo (8, 12, 15 e 18 g) sobre o metabolismo de macrominerais (P, Ca, Mg, Na, K e S), incluindo a ingestão, a concentração no rúmen, a taxa de passagem do líquido ruminal, a excreção nas fezes e a disponibilidade aparente. Utilizaram-se quatro bubalinos adultos com fístulas ruminais em delineamento quadrado latino (4 × 4) com dieta total constituída de cana-de-açúcar como volumoso (85%) e concentrado formulado com um dos níveis de fósforo. Os níveis de fósforo não ocasionaram diferença significativa na concentração mineral no rúmen de nenhum mineral estudado. A concentração média de fósforo no conteúdo ruminal foi de 0,98% na matéria seca, enquanto o teor de fósforo nas rações variou de 0,12 a 0,34%, comprovando alta reciclagem de fósforo pela saliva. Níveis crescentes de fósforo na dieta, variando de 8 a 18 g/animal/dia, não influenciam as disponibilidades de cálcio e magnésio. Com o nível de fósforo de 15 g/dia, houve melhor utilização do fósforo da dieta. A ingestão de níveis crescentes de fósforo em g/kg0,75 (X) promoveu aumento linear na excreção fecal desse mineral em g/kg0,75 (Y) e baixos valores de disponibilidade do fósforo, que pode ser estimado pela equação Y = 0,03 + 0,610X, o que indica deficiência desse elemento mineral na dieta para o metabolismo animal.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The effects were assessed of two energy sources in concentrate (ground grain corn vs. citrus pulp) and two nitrogen sources (soybean meal vs. urea) on rumen metabolism in four buffaloes and four zebu cattle (Nellore) with rumen cannula and fed in a 4 × 4 Latin square design with feeds containing 60% sugar cane. Energy supplements had no effect on the rumen ammonia concentration in cattle, but ground grain corn promoted higher ammonia level than citrus pulp in buffalo. Urea produced higher ammonia level than soybean meal in both animal species. On average, the buffaloes maintained a lower rumen ammonia concentration (11.7 mg/dL) than the cattle (14.5 mg/dL). Buffaloes had lower production of acetic acid than cattle (58.7 vs. 61.6 mol/100 mol) and higher of propionic acid (27.4 vs. 23.6 mol/100 mol). There was no difference in the butyric acid production between the buffaloes (13.6 mol/100 mol) and cattle (14.8 mol/100 mol) and neither in the total volatile fatty acids concentration (82.5 vs. 83.6 mM, respectively). The energy or nitrogen sources had no effect on rumen protozoa count in either animal species. The zebu cattle had higher rumen protozoa population (8.8 × 10(5)/mL) than the buffaloes (6.1 × 10(5)/mL). The rumen protozoa population differed between the animal species, except for Dasytricha and Charonina. The buffaloes had a lower Entodinium population than the cattle (61.0 vs 84.9%, respectively) and a greater percentage of species belonging to the Diplodiniinae subfamily than the cattle (28.6 vs. 1.4%, respectively). In cattle, ground corn is a better energy source than citrus pulp for use by Entodinium and Diplodiniinae. In the buffaloes, the Entodinium are favored by urea and Diplodiniinae species by soybean meal.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Neste trabalho, avaliou-se a adição de células íntegras de levedura e seus derivados em dietas para juvenis de tilápia do Nilo. Foram utilizados 144 juvenis machos de tilápia (peso médio de 52,1g) distribuídos em 12 tanques de fibra de vidro (250L), em delineamento inteiramente casualizado, composto por quatro tratamentos e três repetições. Os peixes foram alimentados ad libitum, duas vezes ao dia durante 60 dias, com dietas isoproteicas (28% PB) e isocalóricas (2.900kcal de ED kg-1) contendo levedura íntegra de cana-de-açúcar (LI), levedura autolisada (LA) e parede celular (PC) adicionados na proporção de 25% da proteína bruta total, comparadas com uma dieta controle (CO), sem adição de levedura. Não foram observadas diferenças significativas para conversão alimentar aparente e taxa de eficiência protéica. No entanto, o ganho em peso foi melhor nos peixes alimentados com as dietas LA (114,70g) e PC (131,03g), assim como em relação à taxa de crescimento específico (LA=1,79 e PC=1,93%), à proteína bruta no ganho de peso (LA=14,45 e PC=15,62%) e ao conteúdo corporal proteico (LA=14,89 e PC=15,67g 100g-1). As frações, a parede celular e a levedura autolisada de cana-de-açúcar podem ser utilizadas em dietas para juvenis de tilápia.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Propôs-se, neste trabalho, estimar dados de albedo à superfície terrestre usando-se o sensor Thematic Mapper (TM) do satélite LANDSAT 5 e compará-lo com dados de duas estações agrometeorológicas localizadas em região de Cerrado e a outra em cultivo da cana-de-açúcar. A região de estudo está localizada no município de Santa Rita do Passa Quatro, SP, Brasil. Para a realização do estudo obtiveram-se seis imagens orbitais do satélite Landsat 5 sensores TM, na órbita 220 e ponto 75, nas datas de 22/02, 11/04, 29/05, 01/08, 17/08 e 21/11, todas do ano de 2005, a que correspondem os dias juliano de 53, 101, 149, 213, 229 e 325, respectivamente. As correções geométricas para as imagens foram realizadas e geradas as cartas de albedo. O algoritmo SEBAL estimou satisfatoriamente os valores de albedo de superfícies sobre áreas de cerrado e de cana-de-açúcar, na região de Santa Rita do Passa Quatro, SP, consistentes com observações realizadas do albedo à superfície.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Biomass was the dominating source of energy for human activities until the middle 19th century, when coal, oil, gas and other energy sources became increasingly important but it still represents ca. 10% of the worldwide energy supply. The major part of biomass for energy is still "traditional biomass" used as wood and coal extracted from native forests and thus non-sustainable, used with low efficiency for cooking and home heating, causing pollution problems. This use is largely done in rural areas and it is usually not supported by trading activities. There is now a strong trend to the modernization of biomass use, especially making alcohol from sugar cane thus replacing gasoline, or biodiesel to replace Diesel oil, beyond the production of electricity and vegetable coal using wood from planted forests. As recently as in 2004, sustainable "modern biomass" represented 2% of worldwide energy consumption. This article discusses the perspectives of the "first" and "second" technology generations for liquid fuel production, as well as biomass gaseification to make electricity or syngas that is in turn used in the Fischer-Tropsch process.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The concentration of 15 polycyclic aromatic hydrocarbons (PAHs) in 57 samples of distillates (cachaça, rum, whiskey, and alcohol fuel) has been determined by HPLC-Fluorescence detection. The quantitative analytical profile of PAHs treated by Partial Least Square - Discriminant Analysis (PLS-DA) provided a good classification of the studied spirits based on their PAHs content. Additionally, the classification of the sugar cane derivatives according to the harvest practice was obtained treating the analytical data by Linear Discriminant Analysis (LDA), using naphthalene, acenaphthene, fluorene, phenanthrene, anthracene, fluoranthene, pyrene, benz[a]anthracene, benz[b]fluoranthene, and benz[g,h,i]perylene, as a chemical descriptors.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Herein, we report the concentration of ethyl carbamate (EC) and copper in 380 samples of sugar-cane spirit and 45 samples of manioc spirit as determined by GC-MS and FAAS respectively. The cyanide content determined spectrophotometrically is reported for the manioc spirit. Sugar cane spirit produced by alembic distillation (70,0 µg L-1) shown a lower content of EC than samples produced by column distillation (270 µg L-1). No simple correlation between the content of EC and copper for sugar cane spirit as well among the concentration of EC, copper, and cyanide for manioc spirit could be observed.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The commercial sugar cane spits redistillation decreased up to 92,5% their ethyl carbamate (EC) original content. Quantitative analysis of EC in 15 samples of sugar cane spirit (alembic and column), fresh distilled and collected in situ demonstrated that the urethane is formed mostly after distillation. The average time to achieve the complete EC formation is independent of the diffuse light presence and of the distillation apparatus used. The k obs for urethane formation at 25 ºC was calculate as (3,3 ± 0,5) x 10-5/s and the activation parameters are: ΔH‡ 34 kcal/mol; ΔS‡ - 69 cal/mol K; and ΔG‡ 54 kcal/mol.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Secondary alcohol concentrations in sugar cane spirits from different origins were determined by gas chromatography. A great variation in the concentration of the secondary alcohols was found in these spirits. Of the 33 brands analyzed, 8 of them were found to be out of conformity with the legislation. Sec butanol, for which the maximum allowed concentration level is 100 mg.L-1 in absolute ethanol, was found within a concentration range between 5 mg.L-1, the limit of quantitation (LQ) and 408 mg.L-1 in absolute ethanol. Sugar cane samples from Salinas, MG, were the only ones that exhibited self similarity because of the low concentrations of n-butanol and n-amylic alcohol (< limit of detection LD).