994 resultados para Diagnosis by PCR


Relevância:

90.00% 90.00%

Publicador:

Resumo:

This study was carried out to isolate and determine bacterial agents in outer lesions of sturgeons in Shahid Dr. Beheshti sturgeon propagation and rearing center in Gilan province. Five species of sturgeons were studied from viewpoint of lesions. A number of 167 specimens of Beluga, 76 specimens of Persian sturgeon, 27 specimens of Russian sturgeon, 42 specimens of stellate and finally 23 specimens of ship had bacterial lesions in different outer parts of their bodies. After sampling and purification, bacterial cultures and biochemical tests were done. After the isolation of bacteria from lesions, Edwardsiella tarda was selected by means of PCR. To obtain molecular acceptance, a pair of E. tarda special primer, forward primer ETa2-351 and reverse primer (Edwsp-780r) were reproduced. A number of 12 E. tarda DNA sample were identified by PCR. After molecular diagnosis, Persian sturgeon challenged with E. tarda for determination of pathogenesis. Challenge method was done by means of injection of different dilutes of E. tarda into dorsal muscle. Sampling of hematopoietic organs (kidney, spleen and liver) were carried out and located in Boin's fixator to perform pathology survey. Also, in order to survey of existence and effect of E. tarda, sampling of kidney for bacterial culture was done by molecular and biochemical methods. Results showed that the most lesions in all five species belonged to abdominal surface. Skin and scutes of this part were involved in comparison with other parts. Also, It was removed some samples from lesions to pathological survey. Microscopic observations showed some levels of destruction of epidermis layers, necrosis of dermis cells and destruction of muscular layer of skin. On the other hand, invasion of inflammatory cells and haemorrhagic in dermis were clear. Based on biochemical results, Aeromonas sobria, A cavia . A. hydrophila , Acinetobacter lowffii , A.baumanni , A.cakoaceticus, Pseudomonas putida , P fluorescens , P.aeruginosa , Serratia marcescens , Escherichia coli , Enterobacter aerogenes , Edwardsiella tarda , Proteus mirabilis , kelebsiella oxytoca and Staphylococcus sp. were isolated from outer lesions. Results of PCR confirmed that E. tarda was before and after challenge in 200 bp range. LD50, 96h was determined 1.2 x 10^5 (CFU/ml). Pathological experiments showed lesions in the kidney, including hemorrhages, degeneration of glumeruli and tubular epithelia, degeneration and necrosis of interestitium tissue, accumulation of protein casts in the tubular lumen. It was observed haemorhages, engorged blood vessels, congestion of sinusoids, increased of melanine, melano macrophage centers, degeneration and necrosis of hepatocytes in the liver. In the spleen, it was recorded congestion, degeneration, necrosis changes in the white and red pulpa, blood engorged and detachment of ellipsoid wall.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Nowadays, following was expanded shrimp breeding and culture; viral diseases have been main problem which threatened shrimp industry in the country. Therefore, shrimp samples were obtained from different stages of Litopenaeus vannmei life cycle (larval, post larval, juveniles, adults and broodstocks) based on clinical signs in the breeding center and shrimp farming from Bushehr, Khozestan and Sistan and Baluchestan provinces. Viral diseases were detected by PCR (Polymerase Chain Reaction), histopathology and transmission electron microscopy (TEM) methods. Results of the PCR were indicated present white spot virus (WSV) in juveniles, sub adults and adults shrimp with medium intensity from three provinces, but it was not showed in larval and post larval stages. Histopathological sections were indicated hypertrophy and basophilic Cowdry type A formation in nucleus cells of gill, haematopoietic, lymphoid and epithelial's cuticles and intestinal tissues which was associated with small vacuoles increased in B cells of hepatopancreas tissue of infection shrimps. Transmission electronic microscopic studies were demonstrated that the length and diameter virus was detected, respectively, 300 ± 20 nm and 75 ± 5 nm. Considerable, results of the PCR were only displayed IHHNV in juvenile, adult and broodstock shrimps from breeding and farming center of Bushehr province. The main lesion pathology was formed eosinophilic Cowdry type A in nucleus cells of gill, haematopoietic, lymphoid and epithelial's cuticles and intestinal tissues. Whereas penaeid shrimps are lack specific immune system, hence, in the present study was used of marine alga (Lurensia snideria) collected from along costal Persian Gulf of Bushehr province for viral diseases were prevented. Powder alga extract were added with a ratio of 1 % to shrimp diet. Total haemocyte count (THC) and total protein plasma (TPP) were increased after 5 days of oral administration diets. When shrimps were infected by with spot virus experimentally, THC and TPP gradually were increased in both two groups (shrimps fed with diet containing alga extract and without alga extract) after 48h. Nevertheless; THC, TPP and survival of shrimp fed with diet containing alga extract were more than shrimp control in 15 days. So, oral administration Lurensia snideria extract was capable prevention infected L. vannamei via stimulant specific immune system.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Background: Hookworm eggs identification and quantification is usually carried out by Kato-Katz method. However various structures present in the smear may be confused with eggs of such parasites. Objective: To document the presence of structures in Kato-Katz slides that could initially be misinterpreted as hookworm eggs. Method: 497 faecal samples were analysed by Kato-Katz technique, diphasic concentration technique, agar-plate coprocultive and larvae obtained were analysed by PCR and characterized by sequencing. Results: Hookworm-like eggs were found in 159 (32%) of the samples by Kato-Katz, finally identified as Caenorhabditis elegans by PCR technique. Conclusion: The diagnosis of human hookworm eggs, only by the use of Kato-Katz technique can lead to false positives because of similarities with eggs of other free-living worms, from wet soils like those of Rwanda that could contaminate stool samples.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The role of aquaculture in satisfying the global seafood demand is essential. The expansion of the aquaculture sector and the intensification of its activities have enhanced the circulation of infectious agents. Among these, the nervous necrosis virus (NNV) represents the most widespread in the Mediterranean basin. The NNV is responsible for a severe neuropathological condition named viral nervous necrosis (VNN), impacting hugely on fish farms due to the serious disease-associated losses. Therefore, it is fundamental to develop new strategies to limit the impact of VNN in this area, interconnecting several aspects of disease management, diagnosis and prevention. This PhD thesis project, focusing on aquatic animals’ health, deals with these topics. The first two chapters expand the knowledge on VNN epidemiology and distribution, showing the possibility of interspecies transmission, persistent infections and a potential carrier role for invertebrates. The third study expands the horizon of VNN diagnosis, by developing a quick and affordable multiplex RT-PCR able to detect and simultaneously discriminate between NNV variants, reducing considerably the time and costs of genotyping. The fourth study, with the development of a fluorescent in situ hybridization technique and its application to aquatic vertebrates and invertebrates’ tissues, contributes to expand the knowledge on NNV distribution at cellular level, localizing also the replication site of the virus. Finally, the last study dealing with an in vitro evaluation of the NNV susceptibility to a commercial biocide, stress the importance to implement proper disinfectant procedures in fish farms to prevent virus spread and disease outbreaks.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

In this study, 103 unrelated South-American patients with mucopolysaccharidosis type II (MPS II) were investigated aiming at the identification of iduronate-2-sulfatase (IDS) disease causing mutations and the possibility of some insights on the genotype-phenotype correlation The strategy used for genotyping involved the identification of the previously reported inversion/disruption of the IDS gene by PCR and screening for other mutations by PCR/SSCP. The exons with altered mobility on SSCP were sequenced, as well as all the exons of patients with no SSCP alteration. By using this strategy, we were able to find the pathogenic mutation in all patients. Alterations such as inversion/disruption and partial/total deletions of the IDS gene were found in 20/103 (19%) patients. Small insertions/deletions/indels (<22 bp) and point mutations were identified in 83/103 (88%) patients, including 30 novel mutations; except for a higher frequency of small duplications in relation to small deletions, the frequencies of major and minor alterations found in our sample are in accordance with those described in the literature.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Shiga toxigenic Escherichia coli (STEC) and Attaching and effacing E. coli (AEEC) have been associated with diarrhea illness in dogs. From January to December 2006, 92 E. coli isolates from 25 diarrheic dogs were analyzed, by screening for the presence of Shiga toxin-producing (stx 1 and stx 2) and intimin (eae) genes. Twelve isolates were detected by PCR to harbor the Shiga toxin genes (7 the stx 1 (7.6%); 5 the stx 2 (5.4%); and none both of them). Nine (9.8%) of the E. coli isolates studied were eae positive non Shiga toxin-producing. Thirteen (62.0%) isolates, carrying stx or eae gene, also showed a hemolysin production. The strains with virulence genes were also examined for resistance to 12 antimicrobial agents. Resistances to cephalothin (85.7%), streptomycin (81.0%), amoxicillin (71.4%) and gentamicin (71.4%) were predominantly observed.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Aggregatibacter actinomycetemcomitans is an important etiologic agent of the periodontitis and is associated with extra-oral infections. In this study, the detection of the ltxA gene as well as the ltx promoter region from leukotoxic A. actinomycetemcomitans isolated from 50 Brazilian patients with periodontitis and 50 healthy subjects was performed. The leukotoxic activity on HL-60 cells was also evaluated. Leukotoxic activity was determined using a trypan blue exclusion method. The 530 bp deletion in the promoter region was evaluated by PCR using a PRO primer pair. A. actinomycetemcomitans was detected by culture and directly from crude subgingival biofilm by PCR using specific primers. By culture, A. actinomycetemcomitans was detected in nine (18%) of the periodontal patients and one (2%) healthy subject. However, by PCR, this organism was detected in 44% of the periodontal patients and in 16% of the healthy subjects. It was verified a great discrepancy between PCR detection of the ltx operon promoter directly from crude subgingival biofilm and from bacterial DNA. Only one periodontal sample harbored highly leukotoxic A. actinomycetemcomitans. Moreover, biotype II was the most prevalent and no correlation between biotypes and leukotoxic activity was observed. The diversity of leukotoxin expression by A. actinomycetemcomitans suggests a role of this toxin in the pathogenesis of periodontal disease and other infectious diseases.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Isolation of Leishmania parasite and species identification are important for confirmation and to help define the epidemiology of the leishmaniasis. Mice are often used to isolate pathogens, but the most common mouse strains are resistant to infection with parasites from the Leishmania (Viannia) subgenus. In this study we tested the inoculation of interferon gamma knockout (IFNγ KO) mice with biopsy macerates from Leishmania-infected patients to increase the possibility of isolating parasites. Biopsies from twenty five patients with clinical signs of leishmaniasis were taken and tested for the presence of parasites. Immunohistochemical assay (IHC) and conventional histopathology detected the parasite in 88% and 83% of the patients, respectively. Leishmania sp. were isolated in biopsy macerates from 52% of the patients by culture in Grace's insect medium, but 13% of isolates were lost due to contamination. Inoculation of macerates in IFNγ KO mice provides isolation of parasites in 31.8% of the biopsies. Most isolates belong to L. (Viannia) subgenus, as confirmed by PCR, except one that belongs to L. (Leishmania) subgenus. Our preliminary results support the use of IFNγ KO mice to improve the possibility to isolate New World Leishmania species.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

OBJETIVO: Relatar caso ilustrativo de doença granulomatosa crônica cujo diagnóstico ocorreu durante o aparecimento do primeiro episódio infeccioso, colaborando com a iniciativa do Brazilian Group for Immunodeficiency para a sensibilização do pediatra geral em relação ao diagnóstico precoce das imunodeficiências primárias, o que está associado a melhor qualidade de vida e maior sobrevida desses indivíduos. DESCRIÇÃO DE CASO: Paciente do sexo masculino, 39 dias de vida, admitido em pronto-socorro pediátrico por febre alta há cinco dias e irritabilidade. No dia seguinte, observou-se abscesso cervical, isolando-se Staphylococcus aureus comunitário. Durante a internação, ocorreram outros abscessos superficiais e em cadeias ganglionares profundas, além de resposta lenta aos antimicrobianos. Solicitou-se investigação para imunodeficiências, que confirmou a hipótese de doença granulomatosa crônica por quantificação dos ânions superóxido e teste de redução do nitrobluetetrazolio. Paciente foi encaminhado a serviço especializado, no qual identificou-se doador de medula óssea compatível, realizando-se o transplante seis meses após o diagnóstico. Quatro meses após o transplante, ocorreu normalização do burst oxidativo, indicando sucesso. COMENTÁRIOS: O paciente mostrou apresentação típica da doença, o que permitiu seu diagnóstico por pediatras gerais já na primeira infecção, tendo como consequência o acompanhamento por especialistas em imunodeficiências primárias, a introdução da profilaxia antimicrobiana e a procura bem sucedida de doador de medula HLA-compatível.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

O objetivo foi investigar a interação entre fatores dietéticos e polimorfismos de enzimas de metabolização de xenobióticos (GSTM1 e GSTT1) associadas ao câncer de cabeça e pescoço em um estudo caso controle de base hospitalar, no Município de São Paulo, Brasil. Participaram 103 casos incidentes, histologicamente confirmados, e 101 controles. O consumo alimentar foi obtido por um questionário de frequência alimentar validado. Os polimorfismos GSTM1 e GSTT1 foram avaliados pelo método PCR. Observou-se aumento de risco no mais alto tercil de consumo de carne bovina na presença do alelo nulo da GSTM1 (OR = 10,79; IC95%: 2,17-53,64) e GSTT1 (OR = 3,41; IC95%: 0,43-27,21). Considerando-se a razão entre alimentos de origem animal e vegetal, verificou-se para o tercil intermediário a OR = 2,02 (IC95%: 0,24-16,0) e no tercil superior OR = 3,23 (IC95%: 0,40-25,92). Os resultados apontam para uma possível interação entre o consumo de carne e variantes polimórficas dos genes GSTM1 e GSTT1 na modulação do risco para o câncer de cabeça e pescoço, influenciados pelo consumo de alimentos de origem vegetal.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Vibrio parahaemolyticus is a marine bacterium, responsible for gastroenteritis in humans. Most of the clinical isolates produce thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) encoded by tdh and trh genes respectively. In this study, twenty-three V. parahaemolyticus, previously isolated from oysters and mussels were analyzed by PCR using specific primers for the 16S rRNA and virulence genes (tdh, trh and tlh) and for resistance to different classes of antibiotics and PFGE. Nineteen isolates were confirmed by PCR as V. parahaemolyticus. The tlh gene was present in 100% of isolates, the tdh gene was identified in two (10.5%) isolates, whereas the gene trh was not detected. Each isolate was resistant to at least one of the nine antimicrobials tested. Additionally, all isolates possessed the blaTEM-116 gene. The presence of this gene in V. parahaemolyticus indicates the possibility of spreading this gene in the environment. Atypical strains of V. parahaemolyticus were also detected in this study.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Brazilian Spotted Fever (BSF) is a lethal rickettsiosis in humans caused by the bacteria Rickettsia rickettsii, and is endemic in some areas of Brazil. Horses and dogs are part of the disease's life cycle and they may also serve as sentinel animals in epidemiological studies. The first human BSF case in the State of Paraná was reported in 2005. The present study was conducted in the municipality of Almirante Tamandaré, where no previous case of BSF was reported. Serum samples were collected from 71 horses and 20 dogs from nine properties in the area. Ticks were also collected from these animals. All farmers completed a questionnaire about their knowledge of BSF and animal health management. Serum samples were analyzed by indirect immunofluorescent-antibody assay (IFA) using R. rickettsii and R. parkeri as antigens. Ticks were analyzed by PCR for Rickettsia sp., and all of them were PCR-negative. Six horses (8.45%) and 4 dogs (20%) were identified as seropositive. Farmers were not aware of the correlation between the presence of ticks and risk of BSF. Although a non-endemic area, Almirante Tamandaré is a vulnerable environment for BSF and effective tick control measures are required.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

No Espírito Santo, os casos de malária autóctone estão distribuídos na região serrana próximo aos fragmentos de Mata Atlântica. Uma vez que alguns aspectos da doença são obscuros, a detecção das possíveis espécies de vetores pode auxiliar na elucidação de incertezas epidemiológicas. Estudos entomológicos e de infecção natural foram realizados com anofelinos (Diptera: Culicidae) capturados no município de Santa Tereza, ES. Capturas mensais foram realizadas de março de 2004 a fevereiro de 2006. Armadilhas CDC-CO2 foram utilizadas do crepúsculo (18:00h) ao amanhecer (6:00h), para capturar anofelinos nos seguintes habitats: próximo ao domicílio e área aberta (solo), margem e interior da mata (solo e copa). Armadilhas Shannon também foram utilizadas nos mesmos locais que as de CDC-CO2. Capturou-se o total de 2.290 anofelinos distribuídos em 10 espécies. A maior frequência relativa foi de Anopheles (Kerteszia) cruzii Dyar & Knab / A.(K.) homunculus Komp, sendo a maioria capturada em CDC-CO2 instalada na copa da mata. A principal espécie capturada em armadilha Shannon foi A.(Nyssorhynchus) strodei Root. O maior número de anofelinos foi capturado entre julho e setembro das 18:00h às 22:00h. Provavelmente A.(K.) cruzii é responsável pela transmissão da malária dentro ou próximo aos fragmentos de Mata Atlântica. Entretanto, a participação de outras espécies não pode ser ignorada, visto que 53 por cento da amostragem foi constituída pelo subgênero Nyssorhynchus. A detecção de Plasmodium vivax no tórax de A. cruzii, A. parvus (Chagas) e A. galvaoi Causey, Deane & Deane por meio de PCR reforça esse argumento

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Aims: To determine the prevalence and expression of metallo-beta-lactamases (MBL)-encoding genes in Aeromonas species recovered from natural water reservoirs in southeastern Brazil. Methods and Results: Eighty-seven Aeromonas isolates belonging to Aeromonas hydrophila (n = 41) and Aer. jandaei (n = 46) species were tested for MBL production by the combined disk test using imipenem and meropenem disks as substrates and EDTA or thioglycolic acid as inhibitors. The presence of MBL genes was investigated by PCR and sequencing using new consensus primer pairs designed in this study. The cphA gene was found in 97.6% and 100% of Aer. hydrophila and Aer. jandaei isolates, respectively, whereas the acquired MBL genes bla(IMP), bla(VIM) and bla(SPM-1) were not detected. On the other hand, production of MBL activity was detectable in 87.8% and 10.9% of the cphA-positive Aer. hydrophila and Aer. jandaei isolates respectively. Conclusions: Our results indicate that cphA seems to be intrinsic in the environmental isolates of Aer. hydrophila and Aer. jandaei in southeastern Brazil, although, based on the combined disk test, not all of them are apparently able to express the enzymatic activity. Significance and Impact of the Study: These data confirm the presence of MBL-producing Aeromonas species in natural water reservoirs. Risk of water-borne diseases owing to domestic and industrial uses of freshwater should be re-examined from the increase of bacterial resistance point of view