Experimentação em química de compostos organometálicos: preparação do cloreto de dicarbonilciclopentadienilferro(II)

In this work, we describe a new method for obtaining [Fe(CO)2[(eta5-C5H5)Cl] employing simple techniques and low-cost reagents. It is worth mentioning that this method is faster than others reported in the literature. It was applied in laboratory classes for undergraduate students, exploring different concepts in organometallic chemistry and discussing the steps involved in the synthetic route.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Six new cases confirm the clinical molecular profile of complete combined 17α-hydroxylase/ 17,20-lyase deficiency in Brazil

In 2004, Costa-Santos and cols. reported 24 patients from 19 Brazilian families with 17α-hydroxylase deficiency and showed that p.W406R and p.R362C corresponded to 50% and 32% of CYP17A1 mutant alleles, respectively. The present report describes clinical and molecular data of six patients from three inbred Brazilian families with 17α-hydroxlyse deficiency. All patients had hypogonadism, amenorrhea and hypertension at diagnosis. Two sisters were found to be 46,XY with both gonads palpable in the inguinal region. All patients presented hypergonadotrophic hypogonadism, with high levels of ACTH (> 104 ng/mL), suppressed plasmatic renin activity, low levels of potassium (< 2.8 mEq/L) and elevated progesterone levels (> 4.4 ng/mL). Three of them, including two sisters, were homozygous for p.W406R mutation and the other three (two sisters and one cousin) were homozygous for p.R362C. The finding of p.W406R and p.R362C in the CYP17A1 gene here reported in additional families, confirms them as the most frequent mutations causing complete combined 17α-hydroxylase/17,20-lyase deficiency in Brazilian patients.

Estudos dos desniveis e desvios posturais nas atletas que praticam a modalidade esportiva voleibol

Universidade Estadual de Campinas. Faculdade de Educação Física

Physiological implications of the regulation of vacuolar H+-ATPase by chloride ions

Vacuolar H+-ATPase is a large multi-subunit protein that mediates ATP-driven vectorial H+ transport across the membranes. It is widely distributed and present in virtually all eukaryotic cells in intracellular membranes or in the plasma membrane of specialized cells. In subcellular organelles, ATPase is responsible for the acidification of the vesicular interior, which requires an intraorganellar acidic pH to maintain optimal enzyme activity. Control of vacuolar H+-ATPase depends on the potential difference across the membrane in which the proton ATPase is inserted. Since the transport performed by H+-ATPase is electrogenic, translocation of H+-ions across the membranes by the pump creates a lumen-positive voltage in the absence of a neutralizing current, generating an electrochemical potential gradient that limits the activity of H+-ATPase. In many intracellular organelles and cell plasma membranes, this potential difference established by the ATPase gradient is normally dissipated by a parallel and passive Cl- movement, which provides an electric shunt compensating for the positive charge transferred by the pump. The underlying mechanisms for the differences in the requirement for chloride by different tissues have not yet been adequately identified, and there is still some controversy as to the molecular identity of the associated Cl--conducting proteins. Several candidates have been identified: the ClC family members, which may or may not mediate nCl-/H+ exchange, and the cystic fibrosis transmembrane conductance regulator. In this review, we discuss some tissues where the association between H+-ATPase and chloride channels has been demonstrated and plays a relevant physiologic role.

Different coordination modes for disulfoxides towards diorganotin(IV) dichlorides. X-ray crystal structures of 1,2-cis-bis-(phenylsulfinyl)ethene (rac-,cis-cbpse) and adducts [{Ph2SnCl2(meso-bpse)}n] and [{n-Bu2SnCl2(pdtd)}2]

The reactions of meso-1,2-bis(phenylsulfinyl)ethane (meso-bpse) with Ph2SnCl2, 2-phenyl-1,3-dithiane trans-1-trans-3-dioxide (pdtd) with n-Bu2SnCl2 and 1,2-cis-bis-(phenylsulfinyl)ethene (rac-,cis-cbpse) with Ph2SnCl2, in 1:1 molar ratio, yielded [{Ph2SnCl2(meso-bpse)}n], [{n-Bu2SnCl2(pdtd)}2] and [{Ph2SnCl2(rac,cis-cbpse)}x] (x = 2 or n), respectively. All adducts were studied by IR, Mössbauer and 119Sn NMR spectroscopic methods, elemental analysis and single crystal X-ray diffractometry. The X-ray crystal structure of [{Ph2SnCl2(meso-bpse)}n] revealed the occurrence of infinite chains in which the tin(IV) atoms appear in a distorted octahedral geometry with Cl atoms in cis and Ph groups in trans positions. The X-ray crystal structure of [{n-Bu2SnCl2(pdtd)}2] revealed discrete centrosymmetric dimeric species in which the tin(IV) atoms possess a distorted octahedral geometry with bridging disulfoxides in cis and n-butyl moieties in trans positions. The spectroscopic data indicated that the adduct containing the rac,cis-cbpse ligand can be dimeric or polymeric. The X-ray structural analysis of the free rac-,cis-cbpse sulfoxide revealed that the crystals belong to the C2/c space group.

On-line identification of minor flavones from sugarcane juice by LC/UV/MS and post-column derivatization

This work describes the on-line characterization of minor flavones from sugarcane (Saccharum officinarum) juice by high-performance liquid chromatography coupled to diode array UV detection and mass spectrometry (LC/UV/MS) using atmospheric pressure chemical ionization-collision-induced dissociation (APCI-CID-MS/MS) and post-column derivatization using UV shift reagents. HPLC-UV analysis with shift reagents provided information about the substitution pattern in the flavonoid skeleton and, combined with MS data, these techniques allowed for the on-line identification of five "garapa" flavones: luteolin-8-C-glucosyl-7-O-glucuronide; tricin-7-O-neohesperoside-4'-O-rhamnoside; tricin-7-O-methylglucuronate-4'-O-rhamnoside; tricin-7-O-methylglucuronide; swertisin, while four other compounds were partially identified as glycosylflavones. Only swertisin (7-O-methylapigenin-6-C-glucoside) was reported previously in sugarcane molasses.

A century of research: what have we learned about the interaction of Trypanosoma cruzi with host cells?

Since the discovery of Trypanosoma cruzi and the brilliant description of the then-referred to "new tripanosomiasis" by Carlos Chagas 100 years ago, a great deal of scientific effort and curiosity has been devoted to understanding how this parasite invades and colonises mammalian host cells. This is a key step in the survival of the parasite within the vertebrate host, and although much has been learned over this century, differences in strains or isolates used by different laboratories may have led to conclusions that are not as universal as originally interpreted. Molecular genotyping of the CL-Brener clone confirmed a genetic heterogeneity in the parasite that had been detected previously by other techniques, including zymodeme or schizodeme (kDNA) analysis. T. cruzi can be grouped into at least two major phylogenetic lineages: T. cruzi I, mostly associated with the sylvatic cycle and T. cruzi II, linked to human disease; however, a third lineage, T. cruziIII, has also been proposed. Hybrid isolates, such as the CL-Brener clone, which was chosen for sequencing the genome of the parasite (Elias et al. 2005, El Sayed et al. 2005a), have also been identified. The parasite must be able to invade cells in the mammalian host, and many studies have implicated the flagellated trypomastigotes as the main actor in this process. Several surface components of parasites and some of the host cell receptors with which they interact have been described. Herein, we have attempted to identify milestones in the history of understanding T. cruzi- host cell interactions. Different infective forms of T. cruzi have displayed unexpected requirements for the parasite to attach to the host cell, enter it, and translocate between the parasitophorous vacuole to its final cytoplasmic destination. It is noteworthy that some of the mechanisms originally proposed to be broad in function turned out not to be universal, and multiple interactions involving different repertoires of molecules seem to act in concert to give rise to a rather complex interplay of signalling cascades involving both parasite and cellular components.

Occurrence, distribution and abundance of Halobates micans Eschscholtz, 1822 (Heteroptera, Gerridae) along the southeastern Brazilian coast

Data collected during an oceanographic cruise along the southeastern Brazilian coast from Cape Frio (22° 58' S) and Paraná (27° 50' S) in March 1982 showed that the marine insect Halobates micans occurred along the Southeastern Brazilian Bight, but in lower abundance in low-temperature areas due to the intrusion and upwelling of South Atlantic Central Water, and in low-salinity areas in Coastal Water. Insect capture was higher at night and in the oligotrophic Tropical Water. The number of nymphs and adult females was higher, probably because of an active breeding season during the austral summer. Adult sex ratio was 1.3:1.0 (F:M). Floating gas vesicles of benthic Sargassum spp. and petroleum lumps were used by females for egg-laying.

Epidemiologia da Leishmaniose Tegumentar e descrição das populações de flebotomíneos no município de Acrelândia, Acre, Brasil

São apresentadas neste artigo a distribuição da leishmaniose tegumentar (LT) e descrição das populações de flebotomíneos em Acrelândia, Acre. Os dados epidemiológicos foram obtidos a partir de fichas de notificação de casos ocorridos entre 2001 e 2004, e os dados entomológicos são provenientes de capturas com armadilhas luminosas efetuadas entre 2004 e 2005 na zona rural de Acrelândia. Ocorreram 82 novos casos de LT, com idade entre 2 e 69 anos, sendo 75,6% em homens e 83,9% na zona rural. Predominou a LT com lesões únicas (78%). A microscopia direta da lesão, intradermorreação de Montenegro e biópsia apresentaram positividade de 100%, 98% e 79,5%, respectivamente. A resposta ao tratamento farmacológico foi bem sucedida em 71,6% dos casos; a falência terapêutica foi maior em pacientes com diagnóstico exclusivamente clínico (41,2%) e nos que receberam dose diária inadequada de antimonial pentavalente (64,3%). Foram coletados 40 espécimes de flebotomíneos em propriedades rurais com casos de LT (3 gêneros, 14 espécies), sendo 3 espécies conhecidas como vetoras ou possíveis vetoras de Leishmania: Nyssomyia antunesi predominou no peridomicílio (59,1%) e em margens de matas; Nyssomyia whitmani foi freqüente no peridomicílio (15%) e a única espécie encontrada no intradomicílio, e Trichophoromyia ubiquitalis foi capturada no peridomicílio. O uso de dados epidemiológicos existentes no serviço de saúde de Acrelândia, embora com várias limitações, permitiu avaliar a eficácia do diagnóstico e o tratamento empregados no município, enquanto os dados entomológicos coletados podem orientar estudos mais amplos visando identificar os vetores e espécies circulantes na região.

Phlebotomines (Diptera, Psychodidae) in the Speleological Province of the Ribeira Valley: 3. Serra district - area of hostels for tourists who visit the Parque Estadual do Alto Ribeira (PETAR), state of São Paulo, Brazil

Phlebotomines (Diptera, Psychodidae) in the Speleological Province of the Ribeira Valley: 3. Area of hostels for tourists who visit the Parque Estadual do Alto Ribeira (PETAR), state of São Paulo, Brazil. The study characterizes some ecological aspects of the phlebotomine fauna in an endemic area of cutaneous leishmaniasis (CL) situated in the Serra district, Iporanga municipality where the hostels for tourists visiting the PETAR are located. Captures were undertaken on a smallholding and a small farm situated near the hostels, monthly between January/2001 and December/2003 with automatic light traps (ALT) in pigsty, hen-house and veranda of a domicile at the two sites, and in peridomicile of the small farm also with black/white Shannon traps. With the ALT a total of 87,224 phlebotomines representing 19 species and also two hybrids of Nyssomyia intermedia (Lutz & Neiva) and Nyssomyia neivai (Pinto) and two anomalous specimens were captured. The standardized index species abundance was for Ny. intermedia = 1.0 and Ny. neivai = 0.935. The highest frequencies of the smallholding occurred in the pigsty, the Williams' mean/capture for Ny. intermedia being 63.7 specimens and for Ny. neivai 29.2, and on the small farm, in the hen-house, Ny. intermedia 402.6 and Ny. neivai 116.2. A total of 863 phlebotomines (Ny. intermedia: 75.4%; Ny. neivai: 24.3%) were captured with black/white Shannon traps; females of both species being predominant in the white trap. The high frequencies of Ny. intermedia and Ny. neivai, both implicated in CL transmission, indicate the areas presenting risk of the disease.

Morphological features and vascularization study of caprine cyclic corpus luteum

Corpus luteum is a temporary endocrine gland that regulates either the estrous cycle and pregnancy. It presents extreme dependency on the adequate blood supply. This work aims to evaluate goat corpus luteum (CL) vascular density (VD) over the estrous cycle. For that purpose, 20 females were submitted to estrus synchronization/ovulation treatment using a medroxyprogesterone intra-vaginal sponge as well as intramuscular (IM) application of cloprostenol and equine chorionic gonadotrophine (eCG). After sponge removal, estrus was identified at about 72hs. Once treatment was over, female goats were then subdivided into 4 groups (n=5 each) and slaughtered on days 2, 12, 16 and 22 after ovulation (p.o). Ovaries were collected, withdrawn and weighted. CL and ovaries had size and area recorded. Blood samples were collected and the plasma progesterone (P4) was measured through RIA commercial kits. The VD was 24.42±6.66, 36.26±5.61, 8.59±2.2 and 3.97±1.12 vessels/mm² for days 2, 12, 16 and 22 p.o, respectively. Progesterone plasma concentrations were 0.49±0.08, 2.63±0.66, 0.61±0.14 and 0.22±0.04ng/ml for days 2, 12, 16 e 22 p.o, respectively. Studied parameters were affected by the estrous cycle phase. Values greater than 12 p.o were observed. In the present work we observed that ovulation occurred predominantly in the right ovary (70% of the animals), which in turn presented bigger measures than the contra lateral one. There is a meaningful relationship between the weight and size of the ovary and these of CL (r=0.87, r=0.70, respectively, p<0.05). It is possible to conclude that morphology of goat's ovaries and plasma progesterone concentration changed according to estrous cycle stages. We propose these parameters can be used as indicators of CL functional activity.

Avaliação hemodinâmica e metabólica da cetamina e cetamina S(+) após a reposição volêmica com hidroxietilamido 130/0,4 e solução salina hipertônica 7,5%

O objetivo deste estudo foi avaliar os efeitos hemodinâmicos e metabólicos, após a administração de solução salina hipertônica (NaCL) 7,5% ou em associação ao hidroxietilamido (HES), em cães com hipovolemia induzida e tratados com cetamina. Após a indução da hipovolemia, administrou-se NaCl 7,5% (4,0ml kg-1) no grupo hipertônica levógira (GHL) e grupo hipertônica racêmica (GHR) ou HES 130/0,4 na mesma proporção de sangue retirado, associado a NaCl 7,5% (4ml kg-1) no grupo hipertônica colóide levógira (GHCL) e no grupo hipertônica colóide racêmica (GHCR). Após 30 minutos, administrou-se, por via IV, cetamina levógira (CL) (5mg kg-1) no GHL e GHCL ou cetamina racêmica (CR) (10mg kg-1) no GHR e GHCR. Empregou-se a análise de variância de uma única via com repetições múltiplas (ANOVA) e o teste de Student Newman Keuls (P£0,05). A frequência cardíaca e a pressão arterial sistólica foram menores após a hipovolemia e após a CR. As pressões arteriais média e diastólica foram menores após a hipovolemia e cetamina. A pressão venosa central foi maior após a administração do colóide. Os índices cardíaco e sistólico foram menores após a hipovolemia em todos os grupos e, após a fase de expansão no GHL e GHR. A pressão média da artéria pulmonar foi menor após a hipovolemia em todos os grupos. A pressão de oclusão da artéria pulmonar foi maior após o colóide. O índice do trabalho ventricular esquerdo foi menor após a hipovolemia no GHCL e GHCR. O índice da resistência periférica total foi maior após a hipovolemia e menor após a CL. Observou-se acidose metabólica após a hipovolemia e após a cetamina. Ocorreu acidose respiratória após a cetamina no GHL e GHR. Conclui-se que a administração de NaCl 7,5% associado ao HES 130/0,4 promove o restabelecimento imediato dos parâmetros hemodinâmicos e metabólicos no paciente hipovolêmico; a administração isolada de NaCl 7,5% não é capaz de restaurar a PAM no período imediato, mas melhora os demais parâmetros hemodinâmicos e metabólicos; a administração de CR ou CL produz efeitos hemodinâmicos e metabólicos similares no paciente hipovolêmico.

Efeitos cardiovasculares da anestesia dissociativa na reposição volêmica com colóide e solução hipertônica em cães: avaliação biotelemétrica

Avaliaram-se os efeitos cardiovasculares por um período de 24 horas, após a administração de solução salina hipertônica (NaCl) 7,5% ou em associação ao hidroxietilamido 130/0,4 (HES), em cães com hipovolemia induzida e tratados com cetamina levógira ou racêmica. Após a indução da hipovolemia, administrou-se NaCl 7,5% (4mL/kg) no grupo hipertônica levógira (GHL) e no grupo hipertônica racêmica (GHR) ou HES 130/0,4 na mesma proporção de sangue retirado, associado a NaCl 7,5% (4mL/kg) no grupo hipertônica colóide levógira (GHCL) e no grupo hipertônica colóide racêmica (GHCR). Após 30 minutos, administrou-se por via intravenosa, cetamina levógira (CL; 5mg/kg) no GHL e GHCL ou cetamina racêmica (CR; 10mg/kg) no GHR e GHCR. A frequência cardíaca (FC) e a pressão arterial sistólica (PAS) foram menores após a hipovolemia e após a CR. A pressão arterial média (PAM) e a pressão arterial diastólica (PAD) foram menores após a hipovolemia e após a administração de CL e CR. Não foram observadas diferenças significativas entre os grupos em relação à FC, PAS, PAM e PAD durante o período de mensuração por biotelemetria desde T210 até T1440. A administração de HES associado ao NaCl 7,5% propiciou restabelecimento imediato da PAM, a administração de NaCl 7,5% não restaurou a PAM em pacientes hipovolêmicos, a administração de CR ou CL produziu efeitos semelhantes e todos os tratamentos mantiveram estáveis as pressões arteriais e a FC por um período de até 24 horas.

Democracy on the edge: limits and possibilities for the implementation of an urban reform agenda in Brazil

In Brazil the 1990s constituted years of institutional achievements in the fields of housing and urban rights, given the incorporation of the principles of the social function of cities and property, the recognition of tenure rights for slum dwellers and the direct participation of citizens in the decision making process of urban policies, within the 1988 Constitution. These proposals have become the pillars of the Urban Reform agenda which has penetrated the federal government apparatus since the creation of the Ministry of Cities under Lula's administration. The article evaluates the limits and possibilities for the implementation of this agenda through the analysis of two policies proposed by the Ministry: the National Council of Cities and the campaign for Participatory Master Plans. The approach is based on the organization of the Brazilian State in terms of urban development, the relationship with the political system and the characteristics of Brazilian democracy.