987 resultados para Growth-stages


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Squamous cell carcinoma is the most common neoplasm of the larynx, and its evolution depends on tumor staging. Vascular endothelial growth factor is a marker of angiogenesis, and its expression may be related to increased tumor aggressiveness, as evidenced by the presence of cervical lymphatic metastases. To evaluate the expression of the vascular endothelial growth factor marker in non-glottic advanced squamous cell carcinoma of the larynx (T3/T4) and correlate it with the presence of cervical lymph node metastases. Retrospective clinical study and immunohistochemical analysis of vascular endothelial growth factor through the German scale of immunoreactivity in products of non-glottic squamous cell carcinomas. This study analyzed 15 cases of advanced non-glottic laryngeal tumors (T3/T4), four of which exhibited cervical lymphatic metastases. There was no correlation between vascular endothelial growth factor expression and the presence of cervical metastases. Although vascular endothelial growth factor was expressed in a few cases, there was no correlation with the spread of cervical lymph metastases.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tomato (Solanum lycopersicum) shows three growth habits: determinate, indeterminate and semi-determinate. These are controlled mainly by allelic variation in the SELF-PRUNING (SP) gene family, which also includes the florigen gene SINGLE FLOWER TRUSS (SFT). Determinate cultivars have synchronized flower and fruit production, which allows mechanical harvesting in the tomato processing industry, whereas indeterminate ones have more vegetative growth with continuous flower and fruit formation, being thus preferred for fresh market tomato production. The semi-determinate growth habit is poorly understood, although there are indications that it combines advantages of determinate and indeterminate growth. Here, we used near-isogenic lines (NILs) in the cultivar Micro-Tom (MT) with different growth habit to characterize semi-determinate growth and to determine its impact on developmental and productivity traits. We show that semi-determinate genotypes are equivalent to determinate ones with extended vegetative growth, which in turn impacts shoot height, number of leaves and either stem diameter or internode length. Semi-determinate plants also tend to increase the highly relevant agronomic parameter Brix×ripe yield (BRY). Water-use efficiency (WUE), evaluated either directly as dry mass produced per amount of water transpired or indirectly through C isotope discrimination, was higher in semi-determinate genotypes. We also provide evidence that the increases in BRY in semi-determinate genotypes are a consequence of an improved balance between vegetative and reproductive growth, a mechanism analogous to the conversion of the overly vegetative tall cereal varieties into well-balanced semi-dwarf ones used in the Green Revolution.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to evaluate by clinical and laboratory parameters how cystic fibrosis (CF) affects growth and nutritional status of children who were undergoing CF treatment but did not receive newborn screening. A historical cohort study of 52 CF patients younger than 10 years of age were followed in a reference center in Campinas, Southeast Brazil. Anthropometric measurements were abstracted from medical records until March/2010, when neonatal screening program was implemented. Between September/2009 and March/2010, parental height of the 52 CF patients were also measured. Regarding nutritional status, four patients had Z-scores ≤ -2 for height/age (H/A) and body mass index/age (BMI/A). The following variables were associated with improved H/A ratio: fewer hospitalizations, longer time from first appointment to diagnosis, longer time from birth to diagnosis and later onset of respiratory disease. Forced vital capacity [FVC(%)], forced expiratory flow between 25-75% of FVC [FEF25-75(%)], forced expiratory volume in the first second [FEV1(%)], gestational age, birth weight and early respiratory symptoms were associated with IMC/A. Greater number of hospitalizations, diagnosis delay and early onset of respiratory disease had a negative impact on growth. Lower spirometric values, lower gestational age, lower birth weight, and early onset of respiratory symptoms had negative impact on nutritional status. Malnutrition was observed in 7.7% of cases, but 23% of children had nutritional risk.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

ANKHD1 (Ankyrin repeat and KH domain-containing protein 1) is highly expressed and plays an important role in the proliferation and cell cycle progression of multiple myeloma (MM) cells. ANKHD1 downregulation modulates cell cycle gene expression and upregulates p21 irrespective of the TP53 mutational status of MM cell lines. The present study was aimed to investigate the role of ANKHD1 in MM in vitro clonogenicity and in vivo tumourigenicity, as well as the role of ANKHD1 in p21 transcriptional regulation. ANKHD1 silencing in MM cells resulted in significantly low no. of colonies formed and in slow migration as compared to control cells (p < 0.05). Furthermore, in xenograft MM mice models, tumour growth was visibly suppressed in mice injected with ANKHD1 silenced cells compared to the control group. There was a significant decrease in tumour volume (p = 0.006) as well as in weight (p = 0.02) in the group injected with silenced cells compared to those of the control group. Co-immunoprecipitation and chromatin immunoprecipitation (ChIP) assays confirmed the interaction between p21 and ANKHD1. Moreover, overexpression of ANKHD1 downregulated the activity of a p21 promoter in luciferase assays. Decrease in luciferase activity suggests a direct role of ANKHD1 in p21 transcriptional regulation. In addition confocal analysis after U266 cells were treated with Leptomycin B (LMB) for 24 h showed accumulation of ANKHD1 inside the nucleus as compared to untreated cells where ANKHD1 was found to be predominantly in cytoplasm. This suggests ANKHD1 might be shuttling between cytoplasm and nucleus. In conclusion, ANKHD1 promotes MM growth by repressing p21 a potent cell cycle regulator.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

From November 1982 to May 1999, 28 children with Rett syndrome were followed-up for a medium period of 6 years and 2 months. Regression of developmental milestones started at the age between 5 and 20 months. Nineteen cases of typical Rett syndrome had uneventful pre and perinatal periods, loss of previously acquired purposeful hand skills, mental and motor regression and developed hand stereotypies; sixteen had head growth deceleration and 12 gait apraxia. Nine patients were atypical cases, 2 formes frustres, 2 congenital, 3 with early seizure onset, 1 preserved speech and 1 male. Epilepsy was present in 21 patients, predominantly partial seizures and the drug of choise was carbamazepine (15 patients). In the initial evaluation most patients were distributed on Stages II and III and on follow-up on Stages III and IV. Three children died.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: To analyze the effects of detachment and repositioning of the medial pterygoid muscle on the growth of the maxilla and mandible of young rats through cephalometry. METHODS: Thirty one-month-old Wistar rats were used, distributed into three groups: experimental, sham-operated and control. In the experimental group, unilateral detachment and repositioning of the medial pterygoid muscle was performed. The sham-operated group only underwent surgical access, and the control group did not undergo any procedure. The animals were sacrificed at the age of three months. Their soft tissues were removed and the mandible was disarticulated. Radiographs of the skull in axial projection and the hemimandibles in lateral projection were obtained, and cephalometry was performed. The values obtained were subjected to statistical analyses among the groups and between the sides in each group. RESULTS: There were significant differences in the length of the mandible relative to the angular process in the experimental group and in the height of the mandibular body in the sham-operated group. CONCLUSION: The experimental detachment and repositioning of the medial pterygoid muscle during the growth period in rats affected the growth of the angle region, resulting in asymmetry of the mandible.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study analyzed the effects of the unilateral removal and dissection of the masseter muscle on the facial growth of young rats. A total of 30 one-month-old Wistar rats were used. Unilateral complete removal of the masseter muscle was performed in the removal group, and detachment followed by repositioning of the masseter muscle was performed in the dissection group, while only surgical access was performed in the sham-operated group. The animals were sacrificed at three months of age. Axial radiographic projections of the skulls and lateral projections of the hemimandibles were taken. Cephalometric evaluations were made and the values obtained were submitted to statistical analyses. In the removal group, there were contour alterations of the angular process, and a significant homolateral difference in the length of the maxilla and a significant bilateral difference in the height of the mandibular body and the length of the mandible were observed. Comparison among groups revealed significance only in the removal group. It was concluded that the experimental removal of the masseter muscle during the growing period in rats induced atrophic changes in the angular process, as well as asymmetry of the maxilla and shortening of the whole mandible.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of the present study was to assess the association between overbite and craniofacial growth pattern. The sample comprised eighty-six cephalograms obtained during the orthodontic pretreatment phase and analyzed using the Radiocef program to identify the craniofacial landmarks and perform orthodontic measurements. The variables utilized were overbite, the Jarabak percentage and the Vert index, as well as classifications resulting from the interpretation of these measurements. In all the statistical tests, a significance level of 5% was considered. Measurement reliability was checked by calculating method error. Weighted Kappa analysis showed that agreement between the facial types defined by the Vert index and the direction of growth trend established by the Jarabak percentage was not satisfactory. Owing to this lack of equivalency, a potential association between overbite and craniofacial growth pattern was evaluated using the chi-square test, considering the two methods separately. No relationship of dependence between overbite and craniofacial growth pattern was revealed by the results obtained. Therefore, it can be concluded that the classification of facial growth pattern will not be the same when considering the Jarabak and the Ricketts anayses, and that increased overbite cannot be associated with a braquifacial growth pattern, nor can openbite be associated with a dolichofacial growth pattern.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The γ-aminobutyric acid (Gaba) is a non-protein amino acid found in prokaryotes and eukaryotes. Its role in plant development has not been fully established. This study reports a quantification of the levels of endogenous Gaba, as well as investigation of its role in different stages of somatic embryogenesis in Acca sellowiana Berg. (Myrtaceae). Zygotic embryos were used as explants and they were inoculated into the culture medium contained different concentrations of Gaba (0,2, 4, 6, 8 and 10 µM). The highest concentrations of endogenous Gaba were detected between the third and nine days after inoculation, reaching the value of 12.77 µmol.g-1FW. High frequency of somatic embryogenesis was observed in response to 10 µM Gaba. This treatment also resulted in a large number of normal embryos, and the lowest percentage of formation of fused somatic embryos, phenotypic characteristic of most deformed embryos in all treatments. Also, all treatments promoted the formation of the somatic embryos with positive characteristics of development resumption, which however did not originate the seedlings.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In vitro culture of the mutualistic fungus of leaf-cutting ants is troublesome due to its low growth rate, which leads to storage problems and contaminants accumulation. This paper aims at comparing the radial growth rate of the mutualistic fungus of Atta sexdens rubropilosa Forel in two different culture media (Pagnocca B and MEA LP). Although total MEA LP radial growth was greater all along the bioassay, no significant difference was detected between growth efficiencies of the two media. Previous evidences of low growth rate for this fungus were confirmed. Since these data cannot point greater efficiency of one culture medium over the other, MEA LP medium is indicated for in vitro studies with this mutualistic fungus due its simpler composition and translucent color, making the analysis easier.