Patterns Of Seizure Control In Patients With Mesial Temporal Lobe Epilepsy With And Without Hippocampus Sclerosis.

Objective Patients with mesial temporal lobe epilepsy (MTLE) may present unstable pattern of seizures. We aimed to evaluate the occurrence of relapse-remitting seizures in MTLE with (MTLE-HS) and without (MTLE-NL) hippocampal sclerosis. Method We evaluated 172 patients with MTLE-HS (122) or MTLE-NL (50). Relapse-remitting pattern was defined as periods longer than two years of seizure-freedom intercalated with seizure recurrence. Infrequent seizures was considered as up to three seizures per year and frequent seizures as any period of seizures higher than that. Results Thirty-seven (30%) MTLE-HS and 18 (36%) MTLE-NL patients had relapse-remitting pattern (X2, p = 0.470). This was more common in those with infrequent seizures (X2, p < 0.001). Twelve MTLE-HS and one MTLE-NL patients had prolonged seizure remission between the first and second decade of life (X2, p = 0.06). Conclusion Similar proportion of MTLE-HS or MTLE-NL patients present relapse-remitting seizures and this occurs more often in those with infrequent seizures.

G-quadruplex Formation Enhances Splicing Efficiency Of Pax9 Intron 1.

G-quadruplexes are secondary structures present in DNA and RNA molecules, which are formed by stacking of G-quartets (i.e., interaction of four guanines (G-tracts) bounded by Hoogsteen hydrogen bonding). Human PAX9 intron 1 has a putative G-quadruplex-forming region located near exon 1, which is present in all known sequenced placental mammals. Using circular dichroism (CD) analysis and CD melting, we showed that these sequences are able to form highly stable quadruplex structures. Due to the proximity of the quadruplex structure to exon-intron boundary, we used a validated double-reporter splicing assay and qPCR to analyze its role on splicing efficiency. The human quadruplex was shown to have a key role on splicing efficiency of PAX9 intron 1, as a mutation that abolished quadruplex formation decreased dramatically the splicing efficiency of human PAX9 intron 1. The less stable, rat quadruplex had a less efficient splicing when compared to human sequences. Additionally, the treatment with 360A, a strong ligand that stabilizes quadruplex structures, further increased splicing efficiency of human PAX9 intron 1. Altogether, these results provide evidences that G-quadruplex structures are involved in splicing efficiency of PAX9 intron 1.

New Interaction Partners For Nek4.1 And Nek4.2 Isoforms: From The Dna Damage Response To Rna Splicing.

Neks are serine-threonine kinases that are similar to NIMA, a protein found in Aspergillus nidulans which is essential for cell division. In humans there are eleven Neks which are involved in different biological functions besides the cell cycle control. Nek4 is one of the largest members of the Nek family and has been related to the primary cilia formation and in DNA damage response. However, its substrates and interaction partners are still unknown. In an attempt to better understand the role of Nek4, we performed an interactomics study to find new biological processes in which Nek4 is involved. We also described a novel Nek4 isoform which lacks a region of 46 amino acids derived from an insertion of an Alu sequence and showed the interactomics profile of these two Nek4 proteins. Isoform 1 and isoform 2 of Nek4 were expressed in human cells and after an immunoprecipitation followed by mass spectrometry, 474 interacting proteins were identified for isoform 1 and 149 for isoform 2 of Nek4. About 68% of isoform 2 potential interactors (102 proteins) are common between the two Nek4 isoforms. Our results reinforce Nek4 involvement in the DNA damage response, cilia maintenance and microtubule stabilization, and raise the possibility of new functional contexts, including apoptosis signaling, stress response, translation, protein quality control and, most intriguingly, RNA splicing. We show for the first time an unexpected difference between both Nek4 isoforms in RNA splicing control. Among the interacting partners, we found important proteins such as ANT3, Whirlin, PCNA, 14-3-3ε, SRSF1, SRSF2, SRPK1 and hNRNPs proteins. This study provides new insights into Nek4 functions, identifying new interaction partners and further suggests an interesting difference between isoform 1 and isoform 2 of this kinase. Nek4 isoform 1 may have similar roles compared to other Neks and these roles are not all preserved in isoform 2. Besides, in some processes, both isoforms showed opposite effects, indicating a possible fine controlled regulation.

Factors Controlling The Deposition Of Silk Fibroin Nanofibrils During Layer-by-layer Assembly.

The layer-by-layer technique has been used as a powerful method to produce multilayer thin films with tunable properties. When natural polymers are employed, complicated phenomena such as self-aggregation and fibrilogenesis can occur, making it more difficult to obtain and characterize high-quality films. The weak acid and base character of such materials provides multilayer systems that may differ from those found with synthetic polymers due to strong self-organization effects. Specifically, LbL films prepared with chitosan and silk fibroin (SF) often involve the deposition of fibroin fibrils, which can influence the assembly process, surface properties, and overall film functionality. In this case, one has the intriguing possibility of realizing multilayer thin films with aligned nanofibers. In this article, we propose a strategy to control fibroin fibril formation by adjusting the assembly partner. Aligned fibroin fibrils were formed when chitosan was used as the counterpart, whereas no fibrils were observed when poly(allylamine hydrochloride) (PAH) was used. Charge density, which is higher in PAH, apparently stabilizes SF aggregates on the nanometer scale, thereby preventing their organization into fibrils. The drying step between the deposition of each layer was also crucial for film formation, as it stabilizes the SF molecules. Preliminary cell studies with optimized multilayers indicated that cell viability of NIH-3T3 fibroblasts remained between 90 and 100% after surface seeding, showing the potential application of the films in the biomedical field, as coatings and functional surfaces.

Factors associated with the prevalence of hypertension and control practices among elderly residents of São Paulo city, Brazil

The aim of this study was to analyze the prevalence of hypertension and control practices among the elderly. The survey analyzed data from 872 elderly people in São Paulo, Brazil, through a cluster sampling, stratified according to education and income. A Poisson multiple regression model checked for the existence of factors associated with hypertension. The prevalence of self-reported hypertension among the elderly was 46.9%. Variables associated with hypertension were self-rated health, alcohol consumption, gender, and hospitalization in the last year, regardless of age. The three most common measures taken to control hypertension, but only rarely, are oral medication, routine salt-free diet and physical activity. Lifestyle and socioeconomic status did not affect the practice of control, but knowledge about the importance of physical activity was higher among those older people with higher education and greater income. The research suggests that health policies that focus on primary care to encourage lifestyle changes among the elderly are necessary.

Estudo inicial da degradação in vivo de poli(L-co-D,L ácido lático), sintetizado em laboratório, aplicado como prótese tibial em coelhos

The copolymer poly (L-co-D,L lactic acid), PLDLA, has gained prominence in the field of temporary prostheses due to the fact that their time of degradation is quite compatible with the requirement in the case of osseous fracture. In this work the in vivo degradation of devices from copolymer, as a system of plates and screws, used in fixation of the tibia of rabbits was studied. The devices were implanted in 15 adult rabbits, albinos, New Zealand race, and they were used as control devices of alloys of titanium (Ti-6Al-4V/ V grade). The use of copolymers, synthesized in the laboratory, was tested in the repair of fracture in rabbits'tibias, being assessed in the following times: 2 weeks, 2 months and 3 months. Morphological analysis of tissue surrounding the plate and screw system, for 2 weeks of implantation, showed the presence of osteoblasts, indicating a pre bone formation. After 2 months there was new bone formation in the region in contact with the polymer. This bone growth occurred simultaneously with the process of PLDLA degradation, invading the region where there was polymer and after 3 months there was an intense degradation of the copolymer and hence greater tissue invasion compared to 2 months which characterized bone formation in a region where the polymer degraded. The in vivo degradation study of the devices for PLDLA by means of histological evaluations during the period of consolidation of the fracture showed the efficiency of plate and screw system, and it was possible to check formation of bone tissue at the implantation site, without the presence of inflammatory reaction

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Auto-eficácia docente e motivação para a realização do(a) professor(a) de Educação Física Adaptada

Universidade Estadual de Campinas . Faculdade de Educação Física

Hegemonia e contra-hegemonia na construção de políticas de esporte e lazer : a experiência do Consórcio Brasília = Hegemony and counter-hegemony in the process of sport and leisure policy-making : the experience of the Consortium Brasilia

Universidade Estadual de Campinas . Faculdade de Educação Física

Estabilidade motora de pessoas portadoras de Sindrome de Dawn, em tarefas de desenhar

Universidade Estadual de Campinas . Faculdade de Educação Física

Bone response to biosilicates® with different crystal phases

The aim of this study was to investigate the histological and histomorphometrical bone response to three Biosilicates with different crystal phases comparing them to Bioglass®45S5 implants used as control. Ceramic glass Biosilicate and Bioglass®45S5 implants were bilaterally inserted in rabbit femurs and harvested after 8 and 12 weeks. Histological examination did not revealed persistent inflammation or foreign body reaction at implantation sites. Bone and a layer of soft tissue were observed in close contact with the implant surfaces in the medullary canal. The connective tissue presented few elongated cells and collagen fibers located parallel to implant surface. Cortical portion after 8 weeks was the only area that demonstrated significant difference between all tested materials, with Biosilicate 1F and Biosilicate 2F presenting higher bone formation than Bioglass®45S5 and Biosilicate® vitreo (p=0.02). All other areas and periods were statistically non-significant (p>0.05). In conclusion, all tested materials were considered biocompatible, demonstrating surface bone formation and a satisfactory behavior at biological environment.

FiltekTM Silorane and FiltekTM Supreme XT resins: tissue reaction after subcutaneous implantation in isogenic mice

The aim of this study was to evaluate the tissue compatibility of a silorane-based resin system (FiltekTM Silorane) and a methacrylate-based nanoparticle resin (FiltekTM Supreme XT) after implantation in the subcutaneous connective tissue of isogenic mice. One hundred and thirty five male isogenic BALB/c mice were randomly assigned to 12 experimental and 3 control groups, according to the implanted material and the experimental period of 7, 21 and 63 days. At the end of each period, the animals were killed and the tubes with the surrounding tissues were removed and processed for microscopic analysis. Samples were subjected to a descriptive and a semi-quantitative analyses using a 4-point scoring system (0-3) to evaluate the collagen fiber formation and inflammatory infiltrate. Data were statistically analyzed using the Kruskal Wallis test (?=0.05). The results showed that there was no significant difference between the experimental and control groups considering the three evaluation periods (p>0.05). The silorane-based and the methacrylate-based nanoparticle resins presented similar tissue response to that of the empty tube (control group) after subcutaneous implantation in isogenic mice.

Subcutaneous tissue response of isogenic mice to calcium hydroxide-based pastes with chlorhexidine

This study was evaluated the response of subcutaneous connective tissue of isogenic mice to calcium hydroxide-based pastes with chlorhexidine digluconate (CHX). Seventy isogenic male BALB/c mice aged 6-8 weeks and weighing 15-20 g were randomly assigned to 8 groups. The animals received polyethylene tube implants as follows: Groups I, II, and III (n=10) - Calen® paste mixed with 0.4% CHX (experimental paste; Calen/CHX) for 7, 21, and 63 days, respectively; Groups IV, V, and VI (n=10) - UltraCal™ paste mixed with 2% CHX (experimental paste supplied by Ultradent Products Inc.; Ultracal/CHX) for 7, 21, and 63 days, respectively; and Groups VII and VIII (n=5): empty tube for 7 and 21 days, respectively. At the end of the experimental periods, the implants were removed together with the surrounding tissues (skin and subcutaneous connective tissue). The biopsied tissues were subjected to routine processing for histological analysis. Using a descriptive analysis and a four-point (0-3) scoring system, the following criteria were considered for qualitative and quantitative analysis of the tissue around the implanted materials: collagen fiber formation, tissue thickness and inflammatory infiltrate. A quantitative analysis was performed by measuring the thickness (µm), area (µm²) and perimeter (µm) of the reactionary granulomatous tissue formed at the tube ends. Data were analyzed statistically by the Kruskal-Wallis test and Dunn's post-test (α=0.05). Calen/CHX showed biocompatibility with the subcutaneous and reactionary tissues, with areas of discrete fibrosis and normal conjunctive fibrous tissue, though without statistically significant difference (p>0.05) from the control groups. In Groups I to III, there was a predominance of score 1, while in Groups IV to VI scores 2 and 3 predominated for all analyzed parameters. UltraCal/CHX, on the other hand, induced the formation of an inflammatory infiltrate and abundant exudate, suggesting a persistent residual aggression from the material, even 63 days after implant placement. In conclusion, the Calen paste mixed with 0.4% CHX allowed an adequate tissue response, whereas the UltraCal paste mixed with 2% CHX showed unsatisfactory results.

Effect of different cleansers on the weight and ion release of removable partial denture: an in vitro study

OBJECTIVE: Removable partial dentures (RPD) require different hygiene care, and association of brushing and chemical cleansing is the most recommended to control biofilm formation. However, the effect of cleansers has not been evaluated in RPD metallic components. The aim of this study was to evaluate in vitro the effect of different denture cleansers on the weight and ion release of RPD. MATERIAL AND METHODS: Five specimens (12x3 mm metallic disc positioned in a 38x18x4 mm mould filled with resin), 7 cleanser agents [Periogard (PE), Cepacol (CE), Corega Tabs (CT), Medical Interporous (MI), Polident (PO), 0.05% sodium hypochlorite (NaOCl), and distilled water (DW) (control)] and 2 cobalt-chromium alloys [DeguDent (DD), and VeraPDI (VPDI)] were used for each experimental situation. One hundred and eighty immersions were performed and the weight was analyzed with a high precision analytic balance. Data were recorded before and after the immersions. The ion release was analyzed using mass spectrometry with inductively coupled plasma. Data were analyzed by two-way ANOVA and Tukey HSD post hoc test at 5% significance level. RESULTS: Statistical analysis showed that CT and MI had higher values of weight loss with higher change in VPDI alloy compared to DD. The solutions that caused more ion release were NaOCl and MI. CONCLUSIONS: It may be concluded that 0.05% NaOCl and Medical Interporous tablets are not suitable as auxiliary chemical solutions for RPD care.

Synthesis and biocompatibility of an experimental glass ionomer cement prepared by a non-hydrolytic sol-gel method

The aims of this study were to demonstrate the synthesis of an experimental glass ionomer cement (GIC) by the non-hydrolytic sol-gel method and to evaluate its biocompatibility in comparison to a conventional glass ionomer cement (Vidrion R). Four polyethylene tubes containing the tested cements were implanted in the dorsal region of 15 rats, as follows: GI - experimental GIC and GII - conventional GIC. The external tube walls was considered the control group (CG). The rats were sacrificed 7, 21 and 42 days after implant placement for histopathological analysis. A four-point (I-IV) scoring system was used to graduate the inflammatory reaction. Regarding the experimental GIC sintherization, thermogravimetric and x-ray diffraction analysis demonstrated vitreous material formation at 110oC by the sol-gel method. For biocompatibility test, results showed a moderate chronic inflammatory reaction for GI (III), severe for GII (IV) and mild for CG (II) at 7 days. After 21 days, GI presented a mild reaction (II); GII, moderate (III) and CG, mild (II). At 42 days, GI showed a mild/absent inflammatory reaction (II to I), similar to GII (II to I). CG presented absence of chronic inflammatory reaction (I). It was concluded that the experimental GIC presented mild/absent tissue reaction after 42 days, being biocompatible when tested in the connective tissue of rats.